Gene Details:
- Gene ID: AT1G01280
- Gene Symbol: CYP703, CYP703A2
- Gene Name: cytochrome P450, family 703, subfamily A, polypeptide 2
- Description: cytochrome P450, family 703, subfamily A, polypeptide 2;(source:Araport11)
- TAIR Accession: locus:2035267
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009066 — anther — antera (Spanish, exact), 半葯,花粉のう (Japanese, exact), Poaceae anther (narrow), Zea anther (narrow)
- PO:0009071 — anther wall tapetum — pollen sac tapetum (exact), portion of anther wall tapetal tissue (exact), tapete (Spanish, exact), 葯壁タペート組織 (Japanese, exact), Poaceae tapetum (narrow), Zea tapetum (narrow)
- PO:0020048 — microspore — microspora (Spanish, exact), 小胞子 (Japanese, exact), Poaceae microspore (narrow), Zea microspore (narrow)
Gene Ontology:
- GO:0010208 — acts upstream of or within — pollen wall assembly
- GO:0005506 — enables — iron ion binding
- GO:0051791 — acts upstream of or within — medium-chain fatty acid metabolic process
- GO:0010584 — acts upstream of or within — pollen exine formation
- GO:0080110 — acts upstream of or within — sporopollenin biosynthetic process
- GO:0051792 — acts upstream of or within — medium-chain fatty acid biosynthetic process
- GO:0020037 — enables — heme binding
- GO:0009555 — acts upstream of or within — pollen development
- GO:0016709 — enables — oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen
Germplasm Phenotype:
- SALK_119582 — Slightly longer inflorescences, an extended period of blooming, a reduced number of elongated siliques, and overall reduced seed set. About a third of the siliques failed to develop. Pollen was not developed (lower and middle part of the inflorescence) or reduced (apical flowers).
- dex2-1 — Slightly longer inflorescences, an extended period of blooming, a reduced number of elongated siliques, and overall reduced seed set. About a third of the siliques failed to develop. Pollen was not developed (lower and middle part of the inflorescence) or reduced (apical flowers).
Function-related keywords:
Literature:
- Applications of Doubled Haploids in Plant Breeding and Applied Research. DOI: 10.1007/978-1-0716-1315-3_2 ; PMID: 34270024
- High-quality Arabidopsis thaliana Genome Assembly with Nanopore and HiFi Long Reads. DOI: 10.1016/j.gpb.2021.08.003 ; PMID: 34487862
- A CENH3 mutation promotes meiotic exit and restores fertility in SMG7-deficient Arabidopsis. DOI: 10.1371/journal.pgen.1009779 ; PMID: 34591845
- Rapid creation of CENH3-mediated haploid induction lines using a cytosine base editor (CBE). DOI: 10.1111/plb.13482 ; PMID: 36285668
- Heat stress promotes haploid formation during CENH3-mediated genome elimination in Arabidopsis. DOI: 10.1007/s00497-023-00457-8 ; PMID: 36692584
- Recurrent Plant-Specific Duplications of KNL2 and Its Conserved Function as a Kinetochore Assembly Factor. DOI: 10.1093/molbev/msac123 ; PMID: 35671323
- Cycles of satellite and transposon evolution in Arabidopsis centromeres. DOI: 10.1038/s41586-023-06062-z ; PMID: 37198485
- Analysis of the histone H3 gene family in Arabidopsis and identification of the male-gamete-specific variant AtMGH3. DOI: 10.1111/j.1365-313X.2005.02554.x ; PMID: 16262706
- The ENHANCER OF TRY AND CPC1 gene acts redundantly with TRIPTYCHON and CAPRICE in trichome and root hair cell patterning in Arabidopsis. DOI: 10.1016/j.ydbio.2003.12.037 ; PMID: 15063185
- Epidermal cell patterning and differentiation throughout the apical-basal axis of the seedling. DOI: 10.1093/jxb/eri213 ; PMID: 15967776
- Participation of the Arabidopsis bHLH factor GL3 in trichome initiation regulatory events. DOI: 10.1104/pp.107.104521 ; PMID: 17885086
- Distinct and overlapping roles of single-repeat MYB genes in root epidermal patterning. DOI: 10.1016/j.ydbio.2007.09.001 ; PMID: 17931617
- Arabidopsis CAPRICE-LIKE MYB 3 (CPL3) controls endoreduplication and flowering development in addition to trichome and root hair formation. DOI: 10.1242/dev.017947 ; PMID: 18305006
- The TTG1-bHLH-MYB complex controls trichome cell fate and patterning through direct targeting of regulatory loci. DOI: 10.1242/dev.016873 ; PMID: 18434419
- Comprehensive analysis of single-repeat R3 MYB proteins in epidermal cell patterning and their transcriptional regulation in Arabidopsis. DOI: 10.1186/1471-2229-8-81 ; PMID: 18644155
- Transcriptome analysis of Arabidopsis wild-type and gl3-sst sim trichomes identifies four additional genes required for trichome development. DOI: 10.1093/mp/ssp037 ; PMID: 19626137
- Functional diversity of R3 single-repeat genes in trichome development. DOI: 10.1242/dev.021733 ; PMID: 19336467
- A gene regulatory network for root epidermis cell differentiation in Arabidopsis. DOI: 10.1371/journal.pgen.1002446 ; PMID: 22253603
- Expression analysis of an R3-Type MYB transcription factor CPC-LIKE MYB4 (TRICHOMELESS2) and CPL4-Related transcripts in Arabidopsis. DOI: 10.3390/ijms13033478 ; PMID: 22489163
- Control of plant trichome and root-hair development by a tomato (Solanum lycopersicum) R3 MYB transcription factor. DOI: 10.1371/journal.pone.0054019 ; PMID: 23326563
- ALFIN-LIKE 6 is involved in root hair elongation during phosphate deficiency in Arabidopsis. DOI: 10.1111/nph.12194 ; PMID: 23432399
- Tomato (Solanum lycopersicum) homologs of TRIPTYCHON (SlTRY) and GLABRA3 (SlGL3) are involved in anthocyanin accumulation. DOI: 10.4161/psb.24575 ; PMID: 23603939
- Flowering is delayed by mutations in homologous genes CAPRICE and TRYPTICHON in the early flowering Arabidopsis cpl3 mutant. DOI: 10.1016/j.jplph.2013.05.013 ; PMID: 23796522
- Positional signaling and expression of ENHANCER OF TRY AND CPC1 are tuned to increase root hair density in response to phosphate deficiency in Arabidopsis thaliana. DOI: 10.1371/journal.pone.0075452 ; PMID: 24130712
- The paralogous R3 MYB proteins CAPRICE, TRIPTYCHON and ENHANCER OF TRY AND CPC1 play pleiotropic and partly non-redundant roles in the phosphate starvation response of Arabidopsis roots. DOI: 10.1093/jxb/erv259 ; PMID: 26022254
Sequence:
cDNA Sequence
- >AT1G01280.1 CTTGTTGAATATAGAATATAAGATTAGATGATTTTGGTGCTAGCCTCCCTCTTCGCTGTTCTCATTCTTAATGTTCTTCTATGGAGATGGCTCAAGGCTTCAGCATGTAAAGCCCAAAGGCTTCCTCCAGGTCCACCAAGATTGCCTATTTTGGGTAACCTTCTTCAATTGGGGCCTTTACCTCATCGGGACTTGGCTTCTCTATGTGATAAGTACGGCCCACTTGTCTACCTCCGGCTTGGAAATGTAGATGCTATCACAACGAACGATCCCGATACCATCCGTGAGATTCTTTTGCGGCAGGACGATGTTTTTTCATCGAGACCCAAAACACTCGCCGCAGTCCACCTAGCGTATGGATGTGGGGACGTTGCATTAGCGCCAATGGGCCCGCATTGGAAAAGAATGAGGAGGATATGCATGGAACACCTACTTACAACCAAAAGGCTTGAATCTTTTACAACCCAACGGGCTGAGGAAGCTCGGTATCTAATACGAGATGTCTTCAAACGGTCCGAAACCGGAAAGCCGATAAATCTTAAGGAAGTATTGGGTGCTTTCTCTATGAACAATGTGACTAGGATGCTACTAGGGAAACAATTCTTTGGGCCTGGATCTCTAGTTAGCCCAAAAGAAGCCCAAGAGTTTTTGCACATAACTCACAAATTGTTTTGGCTGTTGGGTGTAATTTACCTAGGAGATTACTTGCCATTTTGGAGATGGGTGGATCCGTCCGGATGCGAGAAAGAAATGAGGGACGTGGAGAAGCGTGTTGACGAGTTTCACACTAAGATCATCGACGAGCACAGAAGGGCAAAACTGGAAGATGAAGATAAAAACGGAGACATGGATTTTGTTGACGTTTTGTTGTCTCTACCTGGTGAGAACGGGAAGGCACACATGGAAGACGTTGAAATTAAAGCTCTAATTCAGGACATGATAGCTGCTGCGACAGATACGTCAGCAGTCACAAACGAATGGGCAATGGCTGAAGCGATCAAGCAACCGCGAGTGATGCGTAAAATTCAAGAAGAACTCGATAATGTCGTAGGATCAAATCGAATGGTCGACGAATCGGATCTAGTCCATTTAAACTATCTACGTTGTGTGGTACGAGAGACGTTCCGAATGCATCCAGCCGGACCATTCTTGATCCCTCACGAATCCGTCCGAGCAACAACGATCAACGGCTACTACATCCCGGCAAAGACACGTGTCTTCATCAATACACATGGATTGGGCCGAAACACTAAGATATGGGACGACGTGGAAGACTTCAGGCCAGAACGACACTGGCCCGTTGAAGGTAGCGGACGCGTTGAGATAAGTCATGGACCGGATTTTAAGATATTGCCGTTTAGTGCCGGCAAGAGGAAATGTCCCGGAGCTCCGTTAGGTGTGACGATGGTGCTAATGGCTTTGGCTCGGCTCTTCCATTGCTTTGAATGGTCTTCACCGGGAAATATTGATACGGTGGAAGTTTATGGCATGACTATGCCTAAGGCTAAACCATTACGGGCAATCGCTAAGCCACGATTGGCAGCTCATTTGTACACATAACTTTGGTTTAAATTGAATAATAAAAGCATCTACATTGGACAT
CDS Sequence
- >AT1G01280.1 ATGATTTTGGTGCTAGCCTCCCTCTTCGCTGTTCTCATTCTTAATGTTCTTCTATGGAGATGGCTCAAGGCTTCAGCATGTAAAGCCCAAAGGCTTCCTCCAGGTCCACCAAGATTGCCTATTTTGGGTAACCTTCTTCAATTGGGGCCTTTACCTCATCGGGACTTGGCTTCTCTATGTGATAAGTACGGCCCACTTGTCTACCTCCGGCTTGGAAATGTAGATGCTATCACAACGAACGATCCCGATACCATCCGTGAGATTCTTTTGCGGCAGGACGATGTTTTTTCATCGAGACCCAAAACACTCGCCGCAGTCCACCTAGCGTATGGATGTGGGGACGTTGCATTAGCGCCAATGGGCCCGCATTGGAAAAGAATGAGGAGGATATGCATGGAACACCTACTTACAACCAAAAGGCTTGAATCTTTTACAACCCAACGGGCTGAGGAAGCTCGGTATCTAATACGAGATGTCTTCAAACGGTCCGAAACCGGAAAGCCGATAAATCTTAAGGAAGTATTGGGTGCTTTCTCTATGAACAATGTGACTAGGATGCTACTAGGGAAACAATTCTTTGGGCCTGGATCTCTAGTTAGCCCAAAAGAAGCCCAAGAGTTTTTGCACATAACTCACAAATTGTTTTGGCTGTTGGGTGTAATTTACCTAGGAGATTACTTGCCATTTTGGAGATGGGTGGATCCGTCCGGATGCGAGAAAGAAATGAGGGACGTGGAGAAGCGTGTTGACGAGTTTCACACTAAGATCATCGACGAGCACAGAAGGGCAAAACTGGAAGATGAAGATAAAAACGGAGACATGGATTTTGTTGACGTTTTGTTGTCTCTACCTGGTGAGAACGGGAAGGCACACATGGAAGACGTTGAAATTAAAGCTCTAATTCAGGACATGATAGCTGCTGCGACAGATACGTCAGCAGTCACAAACGAATGGGCAATGGCTGAAGCGATCAAGCAACCGCGAGTGATGCGTAAAATTCAAGAAGAACTCGATAATGTCGTAGGATCAAATCGAATGGTCGACGAATCGGATCTAGTCCATTTAAACTATCTACGTTGTGTGGTACGAGAGACGTTCCGAATGCATCCAGCCGGACCATTCTTGATCCCTCACGAATCCGTCCGAGCAACAACGATCAACGGCTACTACATCCCGGCAAAGACACGTGTCTTCATCAATACACATGGATTGGGCCGAAACACTAAGATATGGGACGACGTGGAAGACTTCAGGCCAGAACGACACTGGCCCGTTGAAGGTAGCGGACGCGTTGAGATAAGTCATGGACCGGATTTTAAGATATTGCCGTTTAGTGCCGGCAAGAGGAAATGTCCCGGAGCTCCGTTAGGTGTGACGATGGTGCTAATGGCTTTGGCTCGGCTCTTCCATTGCTTTGAATGGTCTTCACCGGGAAATATTGATACGGTGGAAGTTTATGGCATGACTATGCCTAAGGCTAAACCATTACGGGCAATCGCTAAGCCACGATTGGCAGCTCATTTGTACACATAA
Protein Sequence
- >AT1G01280.1 MILVLASLFAVLILNVLLWRWLKASACKAQRLPPGPPRLPILGNLLQLGPLPHRDLASLCDKYGPLVYLRLGNVDAITTNDPDTIREILLRQDDVFSSRPKTLAAVHLAYGCGDVALAPMGPHWKRMRRICMEHLLTTKRLESFTTQRAEEARYLIRDVFKRSETGKPINLKEVLGAFSMNNVTRMLLGKQFFGPGSLVSPKEAQEFLHITHKLFWLLGVIYLGDYLPFWRWVDPSGCEKEMRDVEKRVDEFHTKIIDEHRRAKLEDEDKNGDMDFVDVLLSLPGENGKAHMEDVEIKALIQDMIAAATDTSAVTNEWAMAEAIKQPRVMRKIQEELDNVVGSNRMVDESDLVHLNYLRCVVRETFRMHPAGPFLIPHESVRATTINGYYIPAKTRVFINTHGLGRNTKIWDDVEDFRPERHWPVEGSGRVEISHGPDFKILPFSAGKRKCPGAPLGVTMVLMALARLFHCFEWSSPGNIDTVEVYGMTMPKAKPLRAIAKPRLAAHLYT