Gene Details:
- Gene ID: AT1G06160
- Gene Symbol: ERF59, ORA59
- Gene Name: ethylene responsive factor 59, octadecanoid-responsive Arabidopsis AP2/ERF 59
- Description: octadecanoid-responsive AP2/ERF 59;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000013 — cauline leaf — hoja caulinar (Spanish, exact), 茎生葉、茎葉 (Japanese, exact)
- PO:0000230 — inflorescence meristem — meristema de la inflorescencia (Spanish, exact), 花序分裂組織 (Japanese, exact)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- AtIREG2 encodes a tonoplast transport protein involved in iron-dependent nickel detoxification in Arabidopsis thaliana roots. DOI: 10.1074/jbc.M601062200 ; PMID: 16790430
- Molecular cloning and characterization of ATP-phosphoribosyl transferase from Arabidopsis, a key enzyme in the histidine biosynthetic pathway. DOI: 10.1104/pp.122.3.907 ; PMID: 10712555
- Constitutively high expression of the histidine biosynthetic pathway contributes to nickel tolerance in hyperaccumulator plants. DOI: 10.1105/tpc.104.030577 ; PMID: 15923352
- Histidine biosynthesis in plants. DOI: 10.1007/s00726-005-0247-0 ; PMID: 16547652
- Genetic dissection of histidine biosynthesis in Arabidopsis. DOI: 10.1104/pp.107.096511 ; PMID: 17434988
- Mutations in SUPPRESSOR OF VARIEGATION1, a factor required for normal chloroplast translation, suppress var2-mediated leaf variegation in Arabidopsis. DOI: 10.1105/tpc.107.054965 ; PMID: 18599582
- Genome-Wide Identification and Expression Analysis of Pseudouridine Synthase Family in Arabidopsis and Maize. DOI: 10.3390/ijms23052680 ; PMID: 35269820
- Novel CIPK1-associated proteins in Arabidopsis contain an evolutionarily conserved C-terminal region that mediates nuclear localization. DOI: 10.1104/pp.105.065649 ; PMID: 16113215
- Molecular characterization of Arabidopsis thaliana cDNAs encoding three purine biosynthetic enzymes. DOI: 10.1046/j.1365-313x.1994.6010113.x ; PMID: 7920700
- Similar protein phosphatases control starch metabolism in plants and glycogen metabolism in mammals. DOI: 10.1074/jbc.M600519200 ; PMID: 16513634
- Physical association of Arabidopsis hypersensitive induced reaction proteins (HIRs) with the immune receptor RPS2. DOI: 10.1074/jbc.M110.211615 ; PMID: 21757708
- A new family of high-affinity transporters for adenine, cytosine, and purine derivatives in Arabidopsis. DOI: 10.1105/tpc.12.2.291 ; PMID: 10662864
- Characterization of cytokinin and adenine transport in Arabidopsis cell cultures. DOI: 10.1104/pp.108.128454 ; PMID: 18835995
- Recycling of pyridoxine (vitamin B6) by PUP1 in Arabidopsis. DOI: 10.1111/tpj.12195 ; PMID: 23551747
- DNA methylation profiling identifies CG methylation clusters in Arabidopsis genes. DOI: 10.1016/j.cub.2005.01.008 ; PMID: 15668172
- An oligopeptide transporter gene family in Arabidopsis. DOI: 7043 ; PMID: 11788749
- Arabidopsis YELLOW STRIPE-LIKE7 (YSL7) and YSL8 transporters mediate uptake of Pseudomonas virulence factor syringolin A into plant cells. DOI: 10.1094/MPMI-06-13-0163-R ; PMID: 23945001
- A second and differentially expressed glutamyl-tRNA reductase gene from Arabidopsis thaliana. DOI: 10.1007/BF00049321 ; PMID: 8605295
- Regulation of HEMA1 expression by phytochrome and a plastid signal during de-etiolation in Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.2001.00986.x ; PMID: 11309145
- Divergent regulation of the HEMA gene family encoding glutamyl-tRNA reductase in Arabidopsis thaliana: expression of HEMA2 is regulated by sugars, but is independent of light and plastid signalling. DOI: 10.1023/a:1016081114758 ; PMID: 12139011
- Green genes gleaned. DOI: 10.1016/j.tplants.2005.05.005 ; PMID: 15951223
- Induction of isoforms of tetrapyrrole biosynthetic enzymes, AtHEMA2 and AtFC1, under stress conditions and their physiological functions in Arabidopsis. DOI: 10.1104/pp.107.100065 ; PMID: 17416636
- GluTR2 complements a hema1 mutant lacking glutamyl-tRNA reductase 1, but is differently regulated at the post-translational level. DOI: 10.1093/pcp/pcu016 ; PMID: 24449654
- RAS1, a quantitative trait locus for salt tolerance and ABA sensitivity in Arabidopsis. DOI: 10.1073/pnas.0910798107 ; PMID: 20212128
- The Arabidopsis Cys2/His2 zinc finger transcription factor ZAT18 is a positive regulator of plant tolerance to drought stress. DOI: 10.1093/jxb/erx157 ; PMID: 28586434
- A new subfamily of sucrose transporters, SUT4, with low affinity/high capacity localized in enucleate sieve elements of plants. DOI: 10.1105/tpc.12.8.1345 ; PMID: 10948254
- SUT2, a putative sucrose sensor in sieve elements. DOI: 10.1105/tpc.12.7.1153 ; PMID: 10899981
- The AtSUC5 sucrose transporter specifically expressed in the endosperm is involved in early seed development in Arabidopsis. DOI: 10.1111/j.1365-313X.2005.02496.x ; PMID: 16146522
- Functional analysis of LjSUT4, a vacuolar sucrose transporter from Lotus japonicus. DOI: 10.1007/s11103-008-9370-0 ; PMID: 18618272
- Sucrose supply to nematode-induced syncytia depends on the apoplasmic and symplasmic pathways. DOI: 10.1093/jxb/erl285 ; PMID: 17431028
- Two novel disaccharides, rutinose and methylrutinose, are involved in carbon metabolism in Datisca glomerata. DOI: 10.1007/s00425-009-1049-5 ; PMID: 19915863
- Proton-driven sucrose symport and antiport are provided by the vacuolar transporters SUC4 and TMT1/2. DOI: 10.1111/j.1365-313X.2011.04672.x ; PMID: 21668536
- Vacuoles release sucrose via tonoplast-localised SUC4-type transporters. DOI: 10.1111/j.1438-8677.2011.00506.x ; PMID: 21972845
- Routes to the tonoplast: the sorting of tonoplast transporters in Arabidopsis mesophyll protoplasts. DOI: 10.1105/tpc.111.090415 ; PMID: 22253225
- Arabidopsis sucrose transporter SUT4 interacts with cytochrome b5-2 to regulate seed germination in response to sucrose and glucose. DOI: 10.1093/mp/sss001 ; PMID: 22311778
- Photoassimilation, assimilate translocation and plasmodesmal biogenesis in the source leaves of Arabidopsis thaliana grown under an increased atmospheric CO2 concentration. DOI: 10.1093/pcp/pcu004 ; PMID: 24406629
- Arabidopsis AtSUC2 and AtSUC4, encoding sucrose transporters, are required for abiotic stress tolerance in an ABA-dependent pathway. DOI: 10.1111/ppl.12225 ; PMID: 24814155
- Regulation of Sucrose Transporters and Phloem Loading in Response to Environmental Cues. DOI: 10.1104/pp.17.01088 ; PMID: 29158330
- AP3M harbors actin filament binding activity that is crucial for vacuole morphology and stomatal closure in Arabidopsis. DOI: 10.1073/pnas.1901431116 ; PMID: 31431522
- Sugar export from Arabidopsis leaves: actors and regulatory strategies. DOI: 10.1093/jxb/erab241 ; PMID: 34037757
- Mobilizing Vacuolar Sugar Increases Vegetative Triacylglycerol Accumulation. DOI: 10.3389/fpls.2021.708902 ; PMID: 34456949
- Identification of Arabidopsis thaliana phloem RNAs provides a search criterion for phloem-based transcripts hidden in complex datasets of microarray experiments. DOI: 10.1111/j.1365-313X.2008.03555.x ; PMID: 18485061
- Molecular characterization of a receptor-like protein kinase gene from pine (Pinus sylvestris L.). DOI: 10.1007/s00425-005-0184-x ; PMID: 16395588
- Expression profiling and local adaptation of Boechera holboellii populations for water use efficiency across a naturally occurring water stress gradient. DOI: 10.1111/j.1365-294X.2006.02818.x ; PMID: 16626450
- Response diversity of Arabidopsis thaliana ecotypes in elevated [CO2] in the field. DOI: 10.1007/s11103-006-9041-y ; PMID: 16941220
- RLK7, a leucine-rich repeat receptor-like kinase, is required for proper germination speed and tolerance to oxidative stress in Arabidopsis thaliana. DOI: 10.1007/s00425-010-1260-4 ; PMID: 20811905
- The secreted peptide PIP1 amplifies immunity through receptor-like kinase 7. DOI: 10.1371/journal.ppat.1004331 ; PMID: 25188390
- Lateral Inhibition by a Peptide Hormone-Receptor Cascade during Arabidopsis Lateral Root Founder Cell Formation. DOI: 10.1016/j.devcel.2018.11.031 ; PMID: 30581155
Sequence:
cDNA Sequence
- >AT1G06160.1 AAAATATATTAAAATAATAATATTTTGTGTAATAGCCCCCAAATTCAAATATCTAATCCGTTCTATATATTTCCCAAACTTAGTGCCACTTAGACACAATAAGAAAACCGTTAACAAGAAGAAAAAAAAAAGATCGAAAATGGAATATCAAACTAACTTCTTAAGTGGAGAGTTTTCCCCGGAGAACTCTTCTTCAAGCTCATGGAGCTCACAAGAATCATTCTTGTGGGAAGAGAGTTTCTTACATCAATCATTTGACCAATCCTTCCTTTTATCTAGCCCTACTGATAACTACTGTGATGACTTCTTTGCATTTGAATCATCAATCATAAAAGAAGAAGGAAAAGAAGCCACCGTGGCGGCCGAGGAGGAGGAGAAGTCATACAGAGGAGTGAGGAAACGGCCGTGGGGGAAATTCGCGGCCGAGATAAGAGACTCAACGAGGAAAGGGATAAGAGTGTGGCTTGGGACATTCGACACCGCGGAGGCGGCGGCTCTCGCTTATGATCAGGCGGCTTTCGCTTTGAAAGGCAGCCTCGCAGTACTCAATTTCCCCGCGGATGTCGTTGAAGAATCTCTCCGGAAGATGGAGAATGTGAATCTCAATGATGGAGAGTCTCCGGTGATAGCCTTGAAGAGAAAACACTCCATGAGAAACCGTCCTAGAGGAAAGAAGAAATCTTCTTCTTCTTCGACGTTGACATCTTCTCCTTCTTCCTCCTCCTCCTATTCATCTTCTTCGTCTTCTTCTTCTTTGTCGTCAAGAAGTAGAAAACAGAGTGTTGTTATGACGCAAGAAAGTAATACAACACTTGTGGTTCTTGAGGATTTAGGTGCTGAATACTTAGAAGAGCTTATGAGATCATGTTCTTGATAATCTCTGCTTCTACAATTTTTATGTAATTTGAGTGAGCTCTGTTTTTTTAAGAAAAAATCCGTTGAAAAGTTTTGGAAGAGATGTGATGGCCGTGTATAGATGTCAACTATTTGCGTTACTGTTGGAAACATGTATAGATGTGTAGTTCTTTATCTTGGTGCTTAATTTTAATATTTATTTTTGCCATAATTCTACAAAACCGATCCGAG
CDS Sequence
- >AT1G06160.1 ATGGAATATCAAACTAACTTCTTAAGTGGAGAGTTTTCCCCGGAGAACTCTTCTTCAAGCTCATGGAGCTCACAAGAATCATTCTTGTGGGAAGAGAGTTTCTTACATCAATCATTTGACCAATCCTTCCTTTTATCTAGCCCTACTGATAACTACTGTGATGACTTCTTTGCATTTGAATCATCAATCATAAAAGAAGAAGGAAAAGAAGCCACCGTGGCGGCCGAGGAGGAGGAGAAGTCATACAGAGGAGTGAGGAAACGGCCGTGGGGGAAATTCGCGGCCGAGATAAGAGACTCAACGAGGAAAGGGATAAGAGTGTGGCTTGGGACATTCGACACCGCGGAGGCGGCGGCTCTCGCTTATGATCAGGCGGCTTTCGCTTTGAAAGGCAGCCTCGCAGTACTCAATTTCCCCGCGGATGTCGTTGAAGAATCTCTCCGGAAGATGGAGAATGTGAATCTCAATGATGGAGAGTCTCCGGTGATAGCCTTGAAGAGAAAACACTCCATGAGAAACCGTCCTAGAGGAAAGAAGAAATCTTCTTCTTCTTCGACGTTGACATCTTCTCCTTCTTCCTCCTCCTCCTATTCATCTTCTTCGTCTTCTTCTTCTTTGTCGTCAAGAAGTAGAAAACAGAGTGTTGTTATGACGCAAGAAAGTAATACAACACTTGTGGTTCTTGAGGATTTAGGTGCTGAATACTTAGAAGAGCTTATGAGATCATGTTCTTGA
Protein Sequence
- >AT1G06160.1 MEYQTNFLSGEFSPENSSSSSWSSQESFLWEESFLHQSFDQSFLLSSPTDNYCDDFFAFESSIIKEEGKEATVAAEEEEKSYRGVRKRPWGKFAAEIRDSTRKGIRVWLGTFDTAEAAALAYDQAAFALKGSLAVLNFPADVVEESLRKMENVNLNDGESPVIALKRKHSMRNRPRGKKKSSSSSTLTSSPSSSSSYSSSSSSSSLSSRSRKQSVVMTQESNTTLVVLEDLGAEYLEELMRSCS