Gene Details:

  • Gene ID: AT2G32950
  • Gene Symbol: ATCOP1, COP1, DET340, EMB168, FUS1
  • Gene Name: ARABIDOPSIS THALIANA CONSTITUTIVE PHOTOMORPHOGENIC 1, CONSTITUTIVE PHOTOMORPHOGENIC 1, DEETIOLATED MUTANT 340, EMBRYO DEFECTIVE 168, FUSCA 1
  • Description: Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
  • TAIR Accession: locus:2059359
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Plant Ontology Annotations:

  • PO:0000037  — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
  • PO:0008019  — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
  • PO:0009005  — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
  • PO:0009006  — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
  • PO:0009009  — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
  • PO:0009025  — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
  • PO:0009029  — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
  • PO:0009031  — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
  • PO:0009046  — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
  • PO:0009052  — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
  • PO:0020030  — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
  • PO:0020038  — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
  • PO:0020100  — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
  • PO:0020137  — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
  • PO:0025022  — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
  • PO:0025281  — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
  • PO:0025195  — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)

Gene Ontology:

  • GO:0006281  — acts upstream of or within — DNA repair
  • GO:0005515  — enables — protein binding
  • GO:0009640  — acts upstream of or within — photomorphogenesis
  • GO:0048573  — acts upstream of or within — photoperiodism, flowering
  • GO:0043161  — involved in — proteasome-mediated ubiquitin-dependent protein catabolic process
  • GO:0061630  — enables — ubiquitin protein ligase activity
  • GO:0010119  — acts upstream of or within — regulation of stomatal movement
  • GO:0042802  — enables — identical protein binding
  • GO:0046283  — acts upstream of or within — anthocyanin-containing compound metabolic process
  • GO:0005634  — located in — nucleus
  • GO:0080008  — part of — Cul4-RING E3 ubiquitin ligase complex
  • GO:0009647  — acts upstream of or within — skotomorphogenesis
  • GO:0009641  — acts upstream of or within — shade avoidance
  • GO:0004842  — enables — ubiquitin-protein transferase activity
  • GO:0016604  — located in — nuclear body
  • GO:0000152  — part of — nuclear ubiquitin ligase complex
  • GO:0009649  — acts upstream of or within — entrainment of circadian clock

Germplasm Phenotype:

  • CS6259  — Blue-light- or dark-grown mutants contain high levels of anthocyanins and are not responsive to cytokinins.
  • CS6259  — Both dark- and light-grown homozygous mutant seedlings are severely retarded in their development, with significantly reduced cell elongation in their hypocotyls and reduced cell enlargement in their cotyledons. Both mature seeds and seedlings homozygous for the mutations exhibit dark purple coloration in their hypocotyls and cotyledons due to high levels of anthocyanin accumulation. Most important, homozygous mutants are adult lethal. Occasionally, some mutant individuals will develop up to three pairs of tiny true leaves before senescence. Not a single mutant plant has been able to survive to reproduce.
  • CS6259  — accumulation of anthocyanins (purple coloration) in cotyledons of developing embryos; dark-grown seedlings resemble light-grown wild-type seedlings having short hypocotyl, open and enlarged cotyledons, accumulation of anthocyanins, chloroplast-like plastid differentiation; expression of light-induced genes in dark-grown plants; light-grown seedlings are heavily pigmented, with anthocyanin accumulation even in roots, open cotyledons, shoots are small and abnormally shaped, lethal (development arrested soon after initiation of primary leaves).
  • CS69040  — Dark-grown cop1-1 seedlings mimic phenotype of light-grown wildtype seedlings. Phenotypes of the dark-grown cop1-1 include the following: short hypocotyls, open and enlarged cotyledons, accumulation of anthocyanins, cell-type differentiation and chloroplast-like plastid differentiation in cotyledons. Light-grown cop1-1 plants have a severe size reduction and greatly reduced seed set than the wildtype.
  • CS69041  — Light-grown cop1-6 plants have a severe size reduction and greatly reduced seed set than the wildtype. Dark-grown cop1-6 plants can bolt and flower; dark-grown cop1-6 have enlarged cotyledons compared to dark-grown wildtype.
  • cop1-1  — Dark- and light-grown strong mutant seedlings have short hypocotyls of similar length.
  • cop1-1  — Dark-grown mutant seedlings are transferred to the light, a significant portion of the seedlings are unable to green and will bleach out and die.
  • cop1-1  — Mutant belonging to the strong class. Milder phenotypes than that observed in the mutants of the lethal class. Not adult lethal although mutation causes a severe size reduction of light-grown mature plants and greatly reduce seed set. Dark-grown seedlings homozygous for the mutation exhibit light-grown characteristics, including patterns of cell differentiation and gene expression.
  • cop1-1  — The mutant does not show additional hypocotyl elongation under far-red light-enriched conditions, whereas the wild-type seedlings display more than a twofold increase in hypocotyl elongation.
  • cop1-1  — Under long-day or continuous light conditions, wild-type plants and the mutant flower after producing approximately seven rosette leaves and growing for 3 to 4 weeks. However, under short-day conditions, wildtype plants produce more than 40 rosette leaves and grow for ~75 days before flowering, whereas the mutant line continues to produce only seven rosette leaves and flower earlier than the wild-type plants.
  • cop1-1 hyh  — Indistinguishable from the respective cop1 mutants when grown in darkness.
  • cop1-1 hyh  — No suppression of the light-dependent cop1 phenotype where seedlings bleach and die when transferred from darkness to light. This is in contrast to the phenotype observed in the other two double mutants: cop1-4/hyh and cop1-6/hyh.
  • cop1-10  — Both dark- and light-grown homozygous mutant seedlings are severely retarded in their development, with significantly reduced cell elongation in their hypocotyls and reduced cell enlargement in their cotyledons. Both mature seeds and seedlings homozygous for the mutations exhibit dark purple coloration in their hypocotyls and cotyledons due to high levels of anthocyanin accumulation. Most important, homozygous mutants are adult lethal. Occasionally, some mutant individuals will develop up to three pairs of tiny true leaves before senescence. Not a single mutant plant has been able to survive to reproduce.
  • cop1-11  — Both dark- and light-grown homozygous mutant seedlings are severely retarded in their development, with significantly reduced cell elongation in their hypocotyls and reduced cell enlargement in their cotyledons. Both mature seeds and seedlings homozygous for the mutations exhibit dark purple coloration in their hypocotyls and cotyledons due to high levels of anthocyanin accumulation. Most important, homozygous mutants are adult lethal. Occasionally, some mutant individuals will develop up to three pairs of tiny true leaves before senescence. Not a single mutant plant has been able to survive to reproduce.
  • cop1-3  — Dark- and light-grown strong mutant seedlings have short hypocotyls of similar length.
  • cop1-3  — Mutant belonging to the strong class. Milder phenotypes than that observed in the mutants of the lethal class. Not adult lethal although mutation causes a severe size reduction of light-grown mature plants and greatly reduce seed set. Dark-grown seedlings homozygous for the mutation exhibit light-grown characteristics, including patterns of cell differentiation and gene expression.
  • cop1-4  — Dark-grown mutant seedlings are transferred to the light, a significant portion of the seedlings are unable to green and will bleach out and die.
  • cop1-4  — Dark-grown seedlings homozygous for weak copl mutations have longer hypocotyls than their light-grown siblings and light-grown wild-type seedlings, although they are clearly shorter than etiolated wild-type seedlings.
  • cop1-4  — Mutant belonging to the weak class. Milder phenotypes than that observed in the mutants of the strong class. Not adult lethal although mutation causes a severe size reduction of light-grown mature plants and greatly reduce seed set. Dark-grown seedlings homozygous for the mutation exhibit light-grown characteristics, including patterns of cell differentiation and gene expression.
  • cop1-4  — The mutant does not show additional hypocotyl elongation under far-red light-enriched conditions, whereas the wild-type seedlings display more than a twofold increase in hypocotyl elongation.
  • cop1-4  — Under long-day or continuous light conditions, wild-type plants and the mutant flower after producing approximately seven rosette leaves and growing for 3 to 4 weeks. However, under short-day conditions, wildtype plants produce more than 40 rosette leaves and grow for ~75 days before flowering, whereas the mutant line continues to produce only seven rosette leaves and flower earlier than the wild-type plants.
  • cop1-4 hyh  — Indistinguishable from the respective cop1 mutants when grown in darkness.
  • cop1-4 hyh  — Suppression in a substantial number of seedlings of the light-dependent cop1 phenotype where seedlings bleach and die when transferred from darkness to light.
  • cop1-6  — Dark-grown mutant seedlings are transferred to the light, a significant portion of the seedlings are unable to green and will bleach out and die.
  • cop1-6  — Dark-grown seedlings homozygous for weak copl mutations have longer hypocotyls than their light-grown siblings and light-grown wild-type seedlings, although they are clearly shorter than etiolated wild-type seedlings.
  • cop1-6  — Mutant belonging to the weak class. Milder phenotypes than that observed in the mutants of the strong class. Not adult lethal although mutation causes a severe size reduction of light-grown mature plants and greatly reduce seed set. Dark-grown seedlings homozygous for the mutation exhibit light-grown characteristics, including patterns of cell differentiation and gene expression.
  • cop1-6  — Roots of the mutant contained ~20-fold the amount of chlorophyll of the wild type.
  • cop1-6  — The mutant does not show additional hypocotyl elongation under far-red light-enriched conditions, whereas the wild-type seedlings display more than a twofold increase in hypocotyl elongation.
  • cop1-6  — Under long-day or continuous light conditions, wild-type plants and the mutant flower after producing approximately seven rosette leaves and growing for 3 to 4 weeks. However, under short-day conditions, wildtype plants produce more than 40 rosette leaves and grow for ~75 days before flowering, whereas the mutant line continues to produce only seven rosette leaves and flower earlier than the wild-type plants.
  • cop1-6 hyh  — Indistinguishable from the respective cop1 mutants when grown in darkness.
  • cop1-6 hyh  — Suppression in a substantial number of seedlings of the light-dependent cop1 phenotype where seedlings bleach and die when transferred from darkness to light.
  • cop1-7  — Both dark- and light-grown homozygous mutant seedlings are severely retarded in their development, with significantly reduced cell elongation in their hypocotyls and reduced cell enlargement in their cotyledons. Both mature seeds and seedlings homozygous for the mutations exhibit dark purple coloration in their hypocotyls and cotyledons due to high levels of anthocyanin accumulation. Most important, homozygous mutants are adult lethal. Occasionally, some mutant individuals will develop up to three pairs of tiny true leaves before senescence. Not a single mutant plant has been able to survive to reproduce.
  • cop1-8  — Both dark- and light-grown homozygous mutant seedlings are severely retarded in their development, with significantly reduced cell elongation in their hypocotyls and reduced cell enlargement in their cotyledons. Both mature seeds and seedlings homozygous for the mutations exhibit dark purple coloration in their hypocotyls and cotyledons due to high levels of anthocyanin accumulation. Most important, homozygous mutants are adult lethal. Occasionally, some mutant individuals will develop up to three pairs of tiny true leaves before senescence. Not a single mutant plant has been able to survive to reproduce.
  • cop1-9  — Both dark- and light-grown homozygous mutant seedlings are severely retarded in their development, with significantly reduced cell elongation in their hypocotyls and reduced cell enlargement in their cotyledons. Both mature seeds and seedlings homozygous for the mutations exhibit dark purple coloration in their hypocotyls and cotyledons due to high levels of anthocyanin accumulation. Most important, homozygous mutants are adult lethal. Occasionally, some mutant individuals will develop up to three pairs of tiny true leaves before senescence. Not a single mutant plant has been able to survive to reproduce.
  • csu4-1/cop1-6  — Restores photomorphogenesis.Double mutant restores etiolated phenotype. Dark grown seedlings show normal hypocotyl elongation.
  • csu4-3/cop1-6  — Restores photomorphogenesis.Double mutant restores etiolated phenotype. Dark grown seedlings show normal hypocotyl elongation.

Literature:

Sequence:

cDNA Sequence
  • >AT2G32950.1 ACCACACCTCAGCCTCACTCCTCCTTCATCTCCGACGTCATACCCAAACCACTCTTTTCTCACAATTCCGATTTTCTCAAAAACCAAAATCACAATCGAAGAAATCTTTTGAAAGCAAAATGGAAGAGATTTCGACGGATCCGGTTGTTCCAGCGGTGAAACCTGACCCGAGAACATCTTCAGTTGGTGAAGGTGCTAATCGTCATGAAAATGACGACGGAGGAAGCGGCGGTTCTGAGATTGGAGCACCGGATCTGGATAAAGACTTGCTTTGTCCGATTTGTATGCAGATTATTAAAGATGCTTTCCTCACGGCTTGTGGTCATAGTTTCTGCTATATGTGTATCATCACACATCTTAGGAACAAGAGTGATTGTCCCTGTTGTAGCCAACACCTCACCAATAATCAGCTTTACCCTAATTTCTTGCTCGATAAGCTATTGAAGAAAACTTCAGCTCGGCATGTGTCAAAAACTGCATCGCCCTTGGATCAGTTTCGGGAAGCACTACAAAGGGGTTGTGATGTGTCAATTAAGGAGGTTGATAATCTTCTGACACTTCTTGCGGAAAGGAAGAGAAAAATGGAACAGGAAGAAGCTGAGAGGAACATGCAGATACTTTTGGACTTTTTGCATTGTCTAAGGAAGCAAAAAGTTGATGAACTAAATGAGGTGCAAACTGATCTCCAGTATATTAAAGAAGATATAAATGCCGTTGAGAGACATAGAATAGATTTATACCGAGCTAGGGACAGATATTCTGTAAAGTTGCGGATGCTCGGAGATGATCCAAGCACAAGAAATGCATGGCCACATGAGAAGAACCAGATTGGTTTCAACTCCAATTCTCTCAGCATAAGAGGAGGAAATTTTGTAGGCAATTATCAAAACAAAAAGGTAGAGGGGAAGGCACAAGGAAGCTCTCATGGGCTACCAAAGAAGGATGCGCTGAGTGGGTCAGATTCGCAAAGTTTGAATCAGTCAACTGTCTCAATGGCTAGAAAGAAACGGATTCATGCTCAGTTCAATGATTTACAAGAATGTTACCTCCAAAAGCGGCGTCAGTTGGCAGACCAACCAAATAGTAAACAAGAAAATGATAAGAGTGTAGTACGGAGGGAAGGCTATAGCAACGGCCTTGCAGATTTTCAATCTGTGTTGACTACCTTCACTCGCTACAGTCGTCTAAGAGTTATAGCAGAAATCCGGCATGGGGATATATTTCATTCAGCCAACATTGTATCAAGCATAGAGTTTGATCGTGATGATGAGCTGTTTGCCACTGCTGGTGTTTCTAGATGTATAAAGGTTTTTGACTTCTCTTCGGTTGTAAATGAACCAGCAGATATGCAGTGTCCGATTGTGGAGATGTCAACTCGGTCTAAACTTAGTTGCTTGAGTTGGAATAAGCATGAAAAAAATCACATAGCAAGCAGTGATTATGAAGGAATAGTAACAGTGTGGGATGTAACTACTAGGCAGAGTCTTATGGAGTATGAAGAGCACGAAAAACGTGCCTGGAGTGTTGACTTTTCACGAACAGAACCATCAATGCTTGTATCTGGTAGTGACGACTGCAAGGTTAAAGTTTGGTGCACGAGGCAGGAAGCAAGTGTGATTAATATTGATATGAAAGCAAACATATGTTGTGTCAAGTACAATCCTGGCTCAAGCAACTACATTGCGGTCGGATCAGCTGATCATCACATCCATTATTACGATCTAAGAAACATAAGCCAACCACTTCATGTCTTCAGTGGACACAAGAAAGCAGTTTCCTATGTTAAATTTTTGTCCAACAACGAGCTCGCTTCTGCGTCCACAGATAGCACACTACGCTTATGGGATGTCAAAGACAACTTGCCAGTTCGAACATTCAGAGGACATACTAACGAGAAGAACTTTGTGGGTCTCACAGTGAACAGCGAGTATCTCGCCTGTGGAAGCGAGACAAACGAAGTATATGTATATCACAAGGAAATCACGAGACCCGTGACATCGCACAGATTTGGATCGCCAGACATGGACGATGCAGAGGAAGAGGCAGGTTCCTACTTTATTAGTGCGGTTTGCTGGAAGAGTGATAGTCCCACGATGTTGACTGCGAATAGTCAAGGAACCATCAAAGTTCTGGTACTCGCTGCGTGATTCTAGTAGACATTACAAAAGATCTTATAGCTTCGTGAATCAATAAAAACAAATTTGCCGTCTATGTTCTTTAGTGGGAGTTACATATAGAGAGAGAACAATTTATTAAAAGTAGGGTTCATCATTTGGAAAGCAACTTTGTATTATTATGCTTGCCTTGGAACACTCCTCAAGAAGAATTTGTATCAGTGATGTAGATATGTCTTACGGTTTCTTAGCTTCTACTTTATATAATTAAATGTTAGAATCAAAATGCGGTGATGTGAATCGGTCATGAAAAGTCAAACCTTGGCTTATACAAAAGGTCCGACCCATGCAATAAGTCAT
  • >AT2G32950.2 ACCACACCTCAGCCTCACTCCTCCTTCATCTCCGACGTCATACCCAAACCACTCTTTTCTCACAATTCCGATTTTCTCAAAAACCAAAATCACAATCGAAGAAATCTTTTGAAAGCAAAATGGAAGAGATTTCGACGGATCCGGTTGTTCCAGCGGTGAAACCTGACCCGAGAACATCTTCAGTTGGTGAAGGTGCTAATCGTCATGAAAATGACGACGGAGGAAGCGGCGGTTCTGAGATTGGAGCACCGGATCTGGATAAAGACTTGCTTTGTCCGATTTGTATGCAGATTATTAAAGATGCTTTCCTCACGGCTTGTGGTCATAGTTTCTGCTATATGTGTATCATCACACATCTTAGGAACAAGAGTGATTGTCCCTGTTGTAGCCAACACCTCACCAATAATCAGCTTTACCCTAATTTCTTGCTCGATAAGCTATTGAAGAAAACTTCAGCTCGGCATGTGTCAAAAACTGCATCGCCCTTGGATCAGTTTCGGGAAGCACTACAAAGGGGTTGTGATGTGTCAATTAAGGAGGTTGATAATCTTCTGACACTTCTTGCGGAAAGGAAGAGAAAAATGGAACAGGAAGAAGCTGAGAGGAACATGCAGATACTTTTGGACTTTTTGCATTGTCTAAGGAAGCAAAAAGTTGATGAACTAAATGAGGTGCAAACTGATCTCCAGTATATTAAAGAAGATATAAATGCCGTTGAGAGACATAGAATAGATTTATACCGAGCTAGGGACAGATATTCTGTAAAGTTGCGGATGCTCGGAGATGATCCAAGCACAAGAAATGCATGGCCACATGAGAAGAACCAGATTGGTTTCAACTCCAATTCTCTCAGCATAAGAGGAGGAAATTTTGTAGGCAATTATCAAAACAAAAAGGTAGAGGGGAAGGCACAAGGAAGCTCTCATGGGCTACCAAAGAAGGATGCGCTGAGTGGGTCAGATTCGCAAAGTTTGAATCAGTCAACTGTCTCAATGGCTAGAAAGAAACGGATTCATGCTCAGTTCAATGATTTACAAGAATGTTACCTCCAAAAGCGGCGTCAGTTGGCAGACCAACCAAATAGTAAACAAGAAAATGATAAGAGTGTAGTACGGAGGGAAGGCTATAGCAACGGCCTTGCAGATTTTCAATCTGTGTTGACTACCTTCACTCGCTACAGTCGTCTAAGAGTTATAGCAGAAATCCGGCATGGGGATATATTTCATTCAGCCAACATTGTATCAAGCATAGAGTTTGATCGTGATGATGAGCTGTTTGCCACTGCTGGTGTTTCTAGATGTATAAAGGTTTTTGACTTCTCTTCGGTTGTAAATGAACCAGCAGATATGCAGTGTCCGATTGTGGAGATGTCAACTCGGTCTAAACTTAGTTGCTTGAGTTGGAATAAGCATGAAAAAAATCACATAGCAAGCAGTGATTATGAAGGAATAGTAACAGTGTGGGATGTAACTACTAGGCAGAGTCTTATGGAGTATGAAGAGCACGAAAAACGTGCCTGGAGTGTTGACTTTTCACGAACAGAACCATCAATGCTTGTATCTGGTAGTGACGACTGCAAGGTTAAAGTTTGGTGCACGAGGCAGGAAGCAAGTGTGATTAATATTGATATGAAAGCAAACATATGTTGTGTCAAGTACAATCCTGGCTCAAGCAACTACATTGCGGTCGGATCAGCTGATCATCACATCCATTATTACGATCTAAGAAACATAAGCCAACCACTTCATGTCTTCAGTGGACACAAGAAAGCAGTTTCCTATGTTAAATTTTTGTCCAACAACGAGCTCGCTTCTGCGTCCACAGATAGCACACTACGCTTATGGGATGTCAAAGACAACTTGCCAGTTCGAACATTCAGAGGACATACTAACGAGAAGAACTTTGTGGGTCTCACAGTGAACAGCGAGTATCTCGCCTGTGGAAGCGAGACAAACGAAGTATATGTATATCACAAGGAAATCACGAGACCCGTGACATCGCACAGATTTGGATCGCCAGACATGGACGATGCAGAGGAAGAGGCAGGTTCCTACTTTATTAGTGCGGTTTGCTGGAAGAGTGATAGTCCCACGATGTTGACTGCGAATAGTCAAGGAACCATCAAAGTTCTGGTACTCGCTGCGTGATTCTAGTAGACATTACAAAAGATCTTATAGCTTCGTGAATCAATAAAAACAAATTTGCCGTCTATGTTCTTTAGTGGGAGTTACATATAGAGAGAGAACAATTTATTAAAAGTAGGGTTCATCATTTGGAAAGCAACTTTGTATTATTATGCTTGCCTTGGAACACTCCTCAAGAAGAATTTGTATCAGTGATGTAGATATGTCTTACGGTTTCTTAGCTTCTACTTTATATAATTAAATGTTAGAATCAAAATGCGGTGATGTGAATCGGTCATGAAAAGTCAAACCTTGGCTTATACAAAAGGTCCGACCCATGCAATAAGTCAT
CDS Sequence
  • >AT2G32950.1 ATGGAAGAGATTTCGACGGATCCGGTTGTTCCAGCGGTGAAACCTGACCCGAGAACATCTTCAGTTGGTGAAGGTGCTAATCGTCATGAAAATGACGACGGAGGAAGCGGCGGTTCTGAGATTGGAGCACCGGATCTGGATAAAGACTTGCTTTGTCCGATTTGTATGCAGATTATTAAAGATGCTTTCCTCACGGCTTGTGGTCATAGTTTCTGCTATATGTGTATCATCACACATCTTAGGAACAAGAGTGATTGTCCCTGTTGTAGCCAACACCTCACCAATAATCAGCTTTACCCTAATTTCTTGCTCGATAAGCTATTGAAGAAAACTTCAGCTCGGCATGTGTCAAAAACTGCATCGCCCTTGGATCAGTTTCGGGAAGCACTACAAAGGGGTTGTGATGTGTCAATTAAGGAGGTTGATAATCTTCTGACACTTCTTGCGGAAAGGAAGAGAAAAATGGAACAGGAAGAAGCTGAGAGGAACATGCAGATACTTTTGGACTTTTTGCATTGTCTAAGGAAGCAAAAAGTTGATGAACTAAATGAGGTGCAAACTGATCTCCAGTATATTAAAGAAGATATAAATGCCGTTGAGAGACATAGAATAGATTTATACCGAGCTAGGGACAGATATTCTGTAAAGTTGCGGATGCTCGGAGATGATCCAAGCACAAGAAATGCATGGCCACATGAGAAGAACCAGATTGGTTTCAACTCCAATTCTCTCAGCATAAGAGGAGGAAATTTTGTAGGCAATTATCAAAACAAAAAGGTAGAGGGGAAGGCACAAGGAAGCTCTCATGGGCTACCAAAGAAGGATGCGCTGAGTGGGTCAGATTCGCAAAGTTTGAATCAGTCAACTGTCTCAATGGCTAGAAAGAAACGGATTCATGCTCAGTTCAATGATTTACAAGAATGTTACCTCCAAAAGCGGCGTCAGTTGGCAGACCAACCAAATAGTAAACAAGAAAATGATAAGAGTGTAGTACGGAGGGAAGGCTATAGCAACGGCCTTGCAGATTTTCAATCTGTGTTGACTACCTTCACTCGCTACAGTCGTCTAAGAGTTATAGCAGAAATCCGGCATGGGGATATATTTCATTCAGCCAACATTGTATCAAGCATAGAGTTTGATCGTGATGATGAGCTGTTTGCCACTGCTGGTGTTTCTAGATGTATAAAGGTTTTTGACTTCTCTTCGGTTGTAAATGAACCAGCAGATATGCAGTGTCCGATTGTGGAGATGTCAACTCGGTCTAAACTTAGTTGCTTGAGTTGGAATAAGCATGAAAAAAATCACATAGCAAGCAGTGATTATGAAGGAATAGTAACAGTGTGGGATGTAACTACTAGGCAGAGTCTTATGGAGTATGAAGAGCACGAAAAACGTGCCTGGAGTGTTGACTTTTCACGAACAGAACCATCAATGCTTGTATCTGGTAGTGACGACTGCAAGGTTAAAGTTTGGTGCACGAGGCAGGAAGCAAGTGTGATTAATATTGATATGAAAGCAAACATATGTTGTGTCAAGTACAATCCTGGCTCAAGCAACTACATTGCGGTCGGATCAGCTGATCATCACATCCATTATTACGATCTAAGAAACATAAGCCAACCACTTCATGTCTTCAGTGGACACAAGAAAGCAGTTTCCTATGTTAAATTTTTGTCCAACAACGAGCTCGCTTCTGCGTCCACAGATAGCACACTACGCTTATGGGATGTCAAAGACAACTTGCCAGTTCGAACATTCAGAGGACATACTAACGAGAAGAACTTTGTGGGTCTCACAGTGAACAGCGAGTATCTCGCCTGTGGAAGCGAGACAAACGAAGTATATGTATATCACAAGGAAATCACGAGACCCGTGACATCGCACAGATTTGGATCGCCAGACATGGACGATGCAGAGGAAGAGGCAGGTTCCTACTTTATTAGTGCGGTTTGCTGGAAGAGTGATAGTCCCACGATGTTGACTGCGAATAGTCAAGGAACCATCAAAGTTCTGGTACTCGCTGCGTGA
  • >AT2G32950.2 ATGGAAGAGATTTCGACGGATCCGGTTGTTCCAGCGGTGAAACCTGACCCGAGAACATCTTCAGTTGGTGAAGGTGCTAATCGTCATGAAAATGACGACGGAGGAAGCGGCGGTTCTGAGATTGGAGCACCGGATCTGGATAAAGACTTGCTTTGTCCGATTTGTATGCAGATTATTAAAGATGCTTTCCTCACGGCTTGTGGTCATAGTTTCTGCTATATGTGTATCATCACACATCTTAGGAACAAGAGTGATTGTCCCTGTTGTAGCCAACACCTCACCAATAATCAGCTTTACCCTAATTTCTTGCTCGATAAGCTATTGAAGAAAACTTCAGCTCGGCATGTGTCAAAAACTGCATCGCCCTTGGATCAGTTTCGGGAAGCACTACAAAGGGGTTGTGATGTGTCAATTAAGGAGGTTGATAATCTTCTGACACTTCTTGCGGAAAGGAAGAGAAAAATGGAACAGGAAGAAGCTGAGAGGAACATGCAGATACTTTTGGACTTTTTGCATTGTCTAAGGAAGCAAAAAGTTGATGAACTAAATGAGGTGCAAACTGATCTCCAGTATATTAAAGAAGATATAAATGCCGTTGAGAGACATAGAATAGATTTATACCGAGCTAGGGACAGATATTCTGTAAAGTTGCGGATGCTCGGAGATGATCCAAGCACAAGAAATGCATGGCCACATGAGAAGAACCAGATTGGTTTCAACTCCAATTCTCTCAGCATAAGAGGAGGAAATTTTGTAGGCAATTATCAAAACAAAAAGGTAGAGGGGAAGGCACAAGGAAGCTCTCATGGGCTACCAAAGAAGGATGCGCTGAGTGGGTCAGATTCGCAAAGTTTGAATCAGTCAACTGTCTCAATGGCTAGAAAGAAACGGATTCATGCTCAGTTCAATGATTTACAAGAATGTTACCTCCAAAAGCGGCGTCAGTTGGCAGACCAACCAAATAGTAAACAAGAAAATGATAAGAGTGTAGTACGGAGGGAAGGCTATAGCAACGGCCTTGCAGATTTTCAATCTGTGTTGACTACCTTCACTCGCTACAGTCGTCTAAGAGTTATAGCAGAAATCCGGCATGGGGATATATTTCATTCAGCCAACATTGTATCAAGCATAGAGTTTGATCGTGATGATGAGCTGTTTGCCACTGCTGGTGTTTCTAGATGTATAAAGGTTTTTGACTTCTCTTCGGTTGTAAATGAACCAGCAGATATGCAGTGTCCGATTGTGGAGATGTCAACTCGGTCTAAACTTAGTTGCTTGAGTTGGAATAAGCATGAAAAAAATCACATAGCAAGCAGTGATTATGAAGGAATAGTAACAGTGTGGGATGTAACTACTAGGCAGAGTCTTATGGAGTATGAAGAGCACGAAAAACGTGCCTGGAGTGTTGACTTTTCACGAACAGAACCATCAATGCTTGTATCTGGTAGTGACGACTGCAAGGTTAAAGTTTGGTGCACGAGGCAGGAAGCAAGTGTGATTAATATTGATATGAAAGCAAACATATGTTGTGTCAAGTACAATCCTGGCTCAAGCAACTACATTGCGGTCGGATCAGCTGATCATCACATCCATTATTACGATCTAAGAAACATAAGCCAACCACTTCATGTCTTCAGTGGACACAAGAAAGCAGTTTCCTATGTTAAATTTTTGTCCAACAACGAGCTCGCTTCTGCGTCCACAGATAGCACACTACGCTTATGGGATGTCAAAGACAACTTGCCAGTTCGAACATTCAGAGGACATACTAACGAGAAGAACTTTGTGGGTCTCACAGTGAACAGCGAGTATCTCGCCTGTGGAAGCGAGACAAACGAAGTATATGTATATCACAAGGAAATCACGAGACCCGTGACATCGCACAGATTTGGATCGCCAGACATGGACGATGCAGAGGAAGAGGCAGGTTCCTACTTTATTAGTGCGGTTTGCTGGAAGAGTGATAGTCCCACGATGTTGACTGCGAATAGTCAAGGAACCATCAAAGTTCTGGTACTCGCTGCGTGA
Protein Sequence
  • >AT2G32950.1 MEEISTDPVVPAVKPDPRTSSVGEGANRHENDDGGSGGSEIGAPDLDKDLLCPICMQIIKDAFLTACGHSFCYMCIITHLRNKSDCPCCSQHLTNNQLYPNFLLDKLLKKTSARHVSKTASPLDQFREALQRGCDVSIKEVDNLLTLLAERKRKMEQEEAERNMQILLDFLHCLRKQKVDELNEVQTDLQYIKEDINAVERHRIDLYRARDRYSVKLRMLGDDPSTRNAWPHEKNQIGFNSNSLSIRGGNFVGNYQNKKVEGKAQGSSHGLPKKDALSGSDSQSLNQSTVSMARKKRIHAQFNDLQECYLQKRRQLADQPNSKQENDKSVVRREGYSNGLADFQSVLTTFTRYSRLRVIAEIRHGDIFHSANIVSSIEFDRDDELFATAGVSRCIKVFDFSSVVNEPADMQCPIVEMSTRSKLSCLSWNKHEKNHIASSDYEGIVTVWDVTTRQSLMEYEEHEKRAWSVDFSRTEPSMLVSGSDDCKVKVWCTRQEASVINIDMKANICCVKYNPGSSNYIAVGSADHHIHYYDLRNISQPLHVFSGHKKAVSYVKFLSNNELASASTDSTLRLWDVKDNLPVRTFRGHTNEKNFVGLTVNSEYLACGSETNEVYVYHKEITRPVTSHRFGSPDMDDAEEEAGSYFISAVCWKSDSPTMLTANSQGTIKVLVLAA
  • >AT2G32950.2 MEEISTDPVVPAVKPDPRTSSVGEGANRHENDDGGSGGSEIGAPDLDKDLLCPICMQIIKDAFLTACGHSFCYMCIITHLRNKSDCPCCSQHLTNNQLYPNFLLDKLLKKTSARHVSKTASPLDQFREALQRGCDVSIKEVDNLLTLLAERKRKMEQEEAERNMQILLDFLHCLRKQKVDELNEVQTDLQYIKEDINAVERHRIDLYRARDRYSVKLRMLGDDPSTRNAWPHEKNQIGFNSNSLSIRGGNFVGNYQNKKVEGKAQGSSHGLPKKDALSGSDSQSLNQSTVSMARKKRIHAQFNDLQECYLQKRRQLADQPNSKQENDKSVVRREGYSNGLADFQSVLTTFTRYSRLRVIAEIRHGDIFHSANIVSSIEFDRDDELFATAGVSRCIKVFDFSSVVNEPADMQCPIVEMSTRSKLSCLSWNKHEKNHIASSDYEGIVTVWDVTTRQSLMEYEEHEKRAWSVDFSRTEPSMLVSGSDDCKVKVWCTRQEASVINIDMKANICCVKYNPGSSNYIAVGSADHHIHYYDLRNISQPLHVFSGHKKAVSYVKFLSNNELASASTDSTLRLWDVKDNLPVRTFRGHTNEKNFVGLTVNSEYLACGSETNEVYVYHKEITRPVTSHRFGSPDMDDAEEEAGSYFISAVCWKSDSPTMLTANSQGTIKVLVLAA