Gene Details:
- Gene ID: AT3G08520
- Gene Symbol: eL41x
- Gene Name: Ribosomal Protein eL41x
- Description: Ribosomal protein L41 family;(source:Araport11)
- TAIR Accession: locus:2103447
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0022625 — located in — cytosolic large ribosomal subunit
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
Sequence:
cDNA Sequence
- >AT3G08520.1 GAACGAAGGAGACAGCTTCTGCGAAATCAGCATGAGAGCCAAGTGGAAGAAGAAGCGTATGAGGAGATTGAAGAGGAAGAGACGAAAGATGAGACAGCGATCTAAGTAGATTCGGGAGTTTGTTTTGTCTTTCTTCTTTTTAGAACCAACTCTTATGTGAGTTTTGTTGGTTTTGCAATTTTCAATTTGAATGTTTTGTTGGACCAAATCGAATCTATGTTTTCTATTAGAATTATGTTTATTACA
CDS Sequence
- >AT3G08520.1 ATGAGAGCCAAGTGGAAGAAGAAGCGTATGAGGAGATTGAAGAGGAAGAGACGAAAGATGAGACAGCGATCTAAGTAG
Protein Sequence
- >AT3G08520.1 MRAKWKKKRMRRLKRKRRKMRQRSK