Gene Details:
- Gene ID: AT3G12500
- Gene Symbol: ATHCHIB, B-CHI, CHI-B, HCHIB, PR-3, PR3
- Gene Name: basic chitinase, basic chitinase, PATHOGENESIS-RELATED 3, PATHOGENESIS-RELATED 3
- Description: basic chitinase;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Function-related keywords:
Literature:
- DNA variation in the basic chitinase locus (ChiB) region of the wild plant Arabidopsis thaliana. DOI: 10.1093/genetics/153.3.1445 ; PMID: 10545472
- Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. DOI: 10.1073/pnas.95.25.15107 ; PMID: 9844023
- Analysis of ethylene signal-transduction kinetics associated with seedling-growth response and chitinase induction in wild-type and mutant arabidopsis. DOI: 10.1104/pp.108.2.597 ; PMID: 7610160
- The Arabidopsis eer1 mutant has enhanced ethylene responses in the hypocotyl and stem. DOI: 10.1104/pp.125.2.1061 ; PMID: 11161061
- Activation of tomato PR and wound-related genes by a mutagenized tomato MAP kinase kinase through divergent pathways. DOI: 10.1023/a:1010633215445 ; PMID: 11437246
- The Arabidopsis mutant cev1 has constitutively active jasmonate and ethylene signal pathways and enhanced resistance to pathogens. DOI: 10.1105/tpc.13.5.1025 ; PMID: 11340179
- Tomato transcription factors pti4, pti5, and pti6 activate defense responses when expressed in Arabidopsis. DOI: 10.1105/tpc.000794 ; PMID: 11971137
- Identification of Arabidopsis ethylene-responsive element binding factors with distinct induction kinetics after pathogen infection. DOI: 10.1104/pp.010862 ; PMID: 11950980
- Conserved MYC transcription factors play a key role in jasmonate signaling both in tomato and Arabidopsis. DOI: 10.1101/gad.297704 ; PMID: 15231736
- Arabidopsis ERF4 is a transcriptional repressor capable of modulating ethylene and abscisic acid responses. DOI: 10.1007/s11103-005-7294-5 ; PMID: 16021341
- AtERF14, a member of the ERF family of transcription factors, plays a nonredundant role in plant defense. DOI: 10.1104/pp.106.086637 ; PMID: 17114278
- GmEREBP1 is a transcription factor activating defense genes in soybean and Arabidopsis. DOI: 10.1094/MPMI-20-2-0107 ; PMID: 17313162
- Molecular and functional profiling of Arabidopsis pathogenesis-related genes: insights into their roles in salt response of seed germination. DOI: 10.1093/pcp/pcn011 ; PMID: 18203731
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Thaxtomin A affects CESA-complex density, expression of cell wall genes, cell wall composition, and causes ectopic lignification in Arabidopsis thaliana seedlings. DOI: 10.1093/jxb/ern344 ; PMID: 19269997
- Characterization of Vitis vinifera NPR1 homologs involved in the regulation of pathogenesis-related gene expression. DOI: 10.1186/1471-2229-9-54 ; PMID: 19432948
- A protein phosphatase 2C, responsive to the bacterial effector AvrRpm1 but not to the AvrB effector, regulates defense responses in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.04047.x ; PMID: 19843314
- Arabidopsis thaliana class-II TGA transcription factors are essential activators of jasmonic acid/ethylene-induced defense responses. DOI: 10.1111/j.1365-313X.2009.04044.x ; PMID: 19832945
- Expression of Arabidopsis pathogenesis-related genes during nematode infection. DOI: 10.1111/j.1364-3703.2010.00675.x ; PMID: 21453430
- The conjugated auxin indole-3-acetic acid-aspartic acid promotes plant disease development. DOI: 10.1105/tpc.111.095190 ; PMID: 22374398
- Indole-3-acetaldoxime-derived compounds restrict root colonization in the beneficial interaction between Arabidopsis roots and the endophyte Piriformospora indica. DOI: 10.1094/MPMI-03-12-0071-R ; PMID: 22852809
- An in vivo expression system for the identification of cargo proteins of vacuolar sorting receptors in Arabidopsis culture cells. DOI: 10.1111/tpj.12257 ; PMID: 23738689
- Identification of proteins enriched in rice egg or sperm cells by single-cell proteomics. DOI: 10.1371/journal.pone.0069578 ; PMID: 23936051
- Growth of Arabidopsis seedlings on high fungal doses of Piriformospora indica has little effect on plant performance, stress, and defense gene expression in spite of elevated jasmonic acid and jasmonic acid-isoleucine levels in the roots. DOI: 10.4161/psb.26301 ; PMID: 24047645
- ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to and ethylene-responsive defence genes. DOI: 10.1111/pce.12583 ; PMID: 26038230
- SENESCENCE-SUPPRESSED PROTEIN PHOSPHATASE Directly Interacts with the Cytoplasmic Domain of SENESCENCE-ASSOCIATED RECEPTOR-LIKE KINASE and Negatively Regulates Leaf Senescence in Arabidopsis. DOI: 10.1104/pp.15.01112 ; PMID: 26304848
- Genome-Wide Screening for Lectin Motifs in Arabidopsis thaliana. DOI: 10.3835/plantgenome2017.02.0010 ; PMID: 28724081
- Enhanced Arabidopsis disease resistance against Botrytis cinerea induced by sulfur dioxide. DOI: 10.1016/j.ecoenv.2017.09.011 ; PMID: 28917191
- Resistance of Fusarium poae in Arabidopsis leaves requires mainly functional JA and ET signaling pathways. DOI: 10.1016/j.funbio.2017.06.001 ; PMID: 28889908
- Exploring expression patterns of PR-1, PR-2, PR-3, and PR-12 like genes in Arabidopsis thaliana upon Alternaria brassicae inoculation. DOI: 10.1007/s13205-018-1259-2 ; PMID: 29719772
- Extracts from cultures of Pseudomonas fluorescens induce defensive patterns of gene expression and enzyme activity while depressing visible injury and reactive oxygen species in Arabidopsis thaliana challenged with pathogenic Pseudomonas syringae. DOI: 10.1093/aobpla/plz049 ; PMID: 31632627
- MYC2-Activated TRICHOME BIREFRINGENCE-LIKE37 Acetylates Cell Walls and Enhances Herbivore Resistance. DOI: 10.1104/pp.20.00683 ; PMID: 32732351
- Isolation of intact vacuoles and proteomic analysis of tonoplast from suspension-cultured cells of Arabidopsis thaliana. DOI: 10.1093/pcp/pch099 ; PMID: 15215502
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- The AP2/ERF domain transcription factor ORA59 integrates jasmonic acid and ethylene signals in plant defense. DOI: 10.1104/pp.108.117523 ; PMID: 18467450
- RD19, an Arabidopsis cysteine protease required for RRS1-R-mediated resistance, is relocalized to the nucleus by the Ralstonia solanacearum PopP2 effector. DOI: 10.1105/tpc.108.058685 ; PMID: 18708476
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequence:
cDNA Sequence
- >AT3G12500.1 ATGCCTCCACAAAAAGAAAACCATAGAACATTGAACAAAATGAAGACTAATCTTTTTCTCTTTCTCATCTTTTCACTTCTCCTATCATTATCCTCGGCCGAGCAATGTGGTCGCCAAGCTGGAGGAGCACTCTGCCCCAACGGTCTATGCTGCAGCGAGTTCGGCTGGTGCGGTAACACCGAACCATACTGTAAGCAGCCTGGCTGCCAAAGCCAGTGCACTCCCGGTGGTACTCCTCCTGGACCCACCGGCGATCTTTCGGGCATCATTTCAAGTTCTCAGTTCGATGATATGCTTAAGCATAGGAATGATGCCGCTTGTCCTGCTAGAGGTTTCTACACTTACAACGCCTTTATCACCGCTGCAAAGTCCTTCCCCGGTTTTGGCACCACCGGAGACACCGCCACGAGGAAGAAGGAGGTCGCCGCCTTCTTCGGCCAGACTTCCCATGAAACTACAGGTGGATGGGCTACAGCACCAGACGGACCATATTCATGGGGCTACTGTTTCAAGCAAGAACAGAATCCTGCTTCAGACTACTGTGAACCGAGCGCCACGTGGCCATGCGCATCTGGCAAACGCTACTACGGAAGAGGACCAATGCAACTGTCGTGGAACTACAATTACGGTCTATGCGGTAGAGCAATAGGAGTTGACTTACTCAACAACCCTGACCTTGTTGCCAACGACGCAGTGATCGCTTTCAAAGCCGCGATTTGGTTCTGGATGACTGCTCAGCCTCCCAAACCGTCTTGCCATGCCGTGATAGCCGGCCAGTGGCAGCCTTCAGACGCCGACCGTGCCGCCGGGAGATTACCGGGTTATGGAGTGATTACGAACATCATTAACGGTGGATTGGAGTGTGGACGTGGCCAAGACGGGAGAGTCGCCGATCGTATAGGGTTTTATCAGAGGTATTGTAACATATTTGGTGTTAATCCTGGTGGTAATCTTGATTGTTACAACCAAAGATCCTTCGTTAACGGCCTCCTCGAAGCTGCTATTTAGTAACGAGAGTATTATTATTATAATATAATACGCAGCTTTGTATTATCAAAACAATAATATCAGACTAATAAAACTCTTTCCAATGATGTTTCACTGTTTATGTTGCGATTTTATTTCCCATGGGCCTTTTTTAATTGGGCTCTCTAGCAGATGAGAGAAAGACGAAGAAAGGTGCATAGATGTTTTAAACTTCGATTACAAGTAAAGGTGTTTGACAATTTCTGTGTGACTCTGCCGACACGTTTCGTATAACGTGCCGCTATCCTCAGCAACGTTTTCATGTGTAATCCAGATTGGTATGAATTTCTATTTAAAATGTTGGTAGCTTAACCGATTGAGGCCAAATCAAACCAATCTATAACTCG
CDS Sequence
- >AT3G12500.1 ATGCCTCCACAAAAAGAAAACCATAGAACATTGAACAAAATGAAGACTAATCTTTTTCTCTTTCTCATCTTTTCACTTCTCCTATCATTATCCTCGGCCGAGCAATGTGGTCGCCAAGCTGGAGGAGCACTCTGCCCCAACGGTCTATGCTGCAGCGAGTTCGGCTGGTGCGGTAACACCGAACCATACTGTAAGCAGCCTGGCTGCCAAAGCCAGTGCACTCCCGGTGGTACTCCTCCTGGACCCACCGGCGATCTTTCGGGCATCATTTCAAGTTCTCAGTTCGATGATATGCTTAAGCATAGGAATGATGCCGCTTGTCCTGCTAGAGGTTTCTACACTTACAACGCCTTTATCACCGCTGCAAAGTCCTTCCCCGGTTTTGGCACCACCGGAGACACCGCCACGAGGAAGAAGGAGGTCGCCGCCTTCTTCGGCCAGACTTCCCATGAAACTACAGGTGGATGGGCTACAGCACCAGACGGACCATATTCATGGGGCTACTGTTTCAAGCAAGAACAGAATCCTGCTTCAGACTACTGTGAACCGAGCGCCACGTGGCCATGCGCATCTGGCAAACGCTACTACGGAAGAGGACCAATGCAACTGTCGTGGAACTACAATTACGGTCTATGCGGTAGAGCAATAGGAGTTGACTTACTCAACAACCCTGACCTTGTTGCCAACGACGCAGTGATCGCTTTCAAAGCCGCGATTTGGTTCTGGATGACTGCTCAGCCTCCCAAACCGTCTTGCCATGCCGTGATAGCCGGCCAGTGGCAGCCTTCAGACGCCGACCGTGCCGCCGGGAGATTACCGGGTTATGGAGTGATTACGAACATCATTAACGGTGGATTGGAGTGTGGACGTGGCCAAGACGGGAGAGTCGCCGATCGTATAGGGTTTTATCAGAGGTATTGTAACATATTTGGTGTTAATCCTGGTGGTAATCTTGATTGTTACAACCAAAGATCCTTCGTTAACGGCCTCCTCGAAGCTGCTATTTAG
Protein Sequence
- >AT3G12500.1 MPPQKENHRTLNKMKTNLFLFLIFSLLLSLSSAEQCGRQAGGALCPNGLCCSEFGWCGNTEPYCKQPGCQSQCTPGGTPPGPTGDLSGIISSSQFDDMLKHRNDAACPARGFYTYNAFITAAKSFPGFGTTGDTATRKKEVAAFFGQTSHETTGGWATAPDGPYSWGYCFKQEQNPASDYCEPSATWPCASGKRYYGRGPMQLSWNYNYGLCGRAIGVDLLNNPDLVANDAVIAFKAAIWFWMTAQPPKPSCHAVIAGQWQPSDADRAAGRLPGYGVITNIINGGLECGRGQDGRVADRIGFYQRYCNIFGVNPGGNLDCYNQRSFVNGLLEAAI