Gene Details:
- Gene ID: AT3G24650
- Gene Symbol: ABI3, ABI3, AtABI3, SIS10
- Gene Name: ABA INSENSITIVE 3, ABSCISIC ACID INSENSITIVE 3, SUGAR INSENSITIVE 10
- Description: AP2/B3-like transcriptional factor family protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0020121 — lateral root — raíz lateral (Spanish, exact), 側根 (Japanese, exact)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009088 — seed coat — cubierta de la semilla (Spanish, exact), portion of seed coat tissue (exact), 種子種皮 (Japanese, exact)
- PO:0009010 — seed — semilla (Spanish, exact), 種子 (Japanese, exact), pyrene (narrow), diaspore (broad)
Function-related keywords:
Literature:
- The Arabidopsis sugar-insensitive mutants sis4 and sis5 are defective in abscisic acid synthesis and response. DOI: 10.1046/j.1365-313x.2000.00833.x ; PMID: 10972885
- Analysis of Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant hormone ABA in the regulation of plant vegetative development by sugar. DOI: NA ; PMID: 10950871
- Mutations causing defects in the biosynthesis and response to gibberellins, abscisic acid and phytochrome B do not inhibit vernalization in Arabidopsis fca-1. DOI: 10.1007/s004250050059 ; PMID: 10787063
- The expression of small heat shock proteins in seeds responds to discrete developmental signals and suggests a general protective role in desiccation tolerance. DOI: 10.1104/pp.122.4.1099 ; PMID: 10759505
- Interactions of the developmental regulator ABI3 with proteins identified from developing Arabidopsis seeds. DOI: 10.1046/j.1365-313x.2000.00663.x ; PMID: 10743655
- The HD-Zip gene ATHB6 in Arabidopsis is expressed in developing leaves, roots and carpels and up-regulated by water deficit conditions. DOI: 10.1023/a:1006267013170 ; PMID: 10527431
- Stress-responsive and developmental regulation of Delta(1)-pyrroline-5-carboxylate synthetase 1 (P5CS1) gene expression in Arabidopsis thaliana. DOI: 10.1006/bbrc.1999.1112 ; PMID: 10441499
- Properties of proteins and the glassy matrix in maturation-defective mutant seeds of Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.1998.00277.x ; PMID: 9839460
- Two novel MYB homologues with changed expression in late embryogenesis-defective Arabidopsis mutants. DOI: 10.1023/a:1006011002499 ; PMID: 9678577
- The expression of a peroxiredoxin antioxidant gene, AtPer1, in Arabidopsis thaliana is seed-specific and related to dormancy. DOI: 10.1023/a:1005900832440 ; PMID: 9580097
- Differential expression of two P5CS genes controlling proline accumulation during salt-stress requires ABA and is regulated by ABA1, ABI1 and AXR2 in Arabidopsis. DOI: 10.1046/j.1365-313x.1997.00557.x ; PMID: 9351242
- The ABSCISIC ACID-INSENSITIVE3, FUSCA3, and LEAFY COTYLEDON1 loci act in concert to control multiple aspects of Arabidopsis seed development. DOI: 10.1105/tpc.9.8.1265 ; PMID: 9286105
- Identification of a receptor-like protein kinase gene rapidly induced by abscisic acid, dehydration, high salt, and cold treatments in Arabidopsis thaliana. DOI: 10.1104/pp.113.4.1203 ; PMID: 9112773
- A genomic perspective on plant transcription factors. DOI: 10.1016/s1369-5266(00)00107-2 ; PMID: 11019812
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Regulation and function of the Arabidopsis ABA-insensitive4 gene in seed and abscisic acid response signaling networks. DOI: 10.1104/pp.124.4.1752 ; PMID: 11115891
- Physical interactions between ABA response loci of Arabidopsis. DOI: 10.1046/j.1365-313x.2001.01069.x ; PMID: 11489176
- A screen for genes that function in abscisic acid signaling in Arabidopsis thaliana. DOI: 10.1093/genetics/161.3.1247 ; PMID: 12136027
- Regulation and role of the Arabidopsis abscisic acid-insensitive 5 gene in abscisic acid, sugar, and stress response. DOI: 10.1104/pp.005793 ; PMID: 12177466
- ABA plays a central role in mediating the regulatory effects of nitrate on root branching in Arabidopsis. DOI: 10.1046/j.1365-313x.2001.01185.x ; PMID: 11851911
- Leafy Cotyledon Mutants of Arabidopsis. DOI: 10.1105/tpc.6.8.1049 ; PMID: 12244265
- Drought Rhizogenesis in Arabidopsis thaliana (Differential Responses of Hormonal Mutants). DOI: 10.1104/pp.104.2.761 ; PMID: 12232124
- ABI5 acts downstream of ABI3 to execute an ABA-dependent growth arrest during germination. DOI: 10.1046/j.1365-313x.2002.01430.x ; PMID: 12410810
- Regulatory networks in seeds integrating developmental, abscisic acid, sugar, and light signaling. DOI: 10.1104/pp.011916 ; PMID: 12529517
- Synergistic activation of seed storage protein gene expression in Arabidopsis by ABI3 and two bZIPs related to OPAQUE2. DOI: 10.1074/jbc.M210538200 ; PMID: 12657652
- The Arabidopsis thaliana homeobox gene ATHB5 is a potential regulator of abscisic acid responsiveness in developing seedlings. DOI: 10.1023/a:1022567625228 ; PMID: 12678559
- The ABSCISIC ACID INSENSITIVE 3 (ABI3) gene is modulated by farnesylation and is involved in auxin signaling and lateral root development in Arabidopsis. DOI: 10.1046/j.1365-313x.2003.01707.x ; PMID: 12662310
- Maize VP1 complements Arabidopsis abi3 and confers a novel ABA/auxin interaction in roots. DOI: 10.1046/j.1365-313x.2001.01165.x ; PMID: 11737778
- Viviparous1 alters global gene expression patterns through regulation of abscisic acid signaling. DOI: 10.1104/pp.103.022475 ; PMID: 12857845
- Three genes that affect sugar sensing (abscisic acid insensitive 4, abscisic acid insensitive 5, and constitutive triple response 1) are differentially regulated by glucose in Arabidopsis. DOI: 10.1104/pp.103.021089 ; PMID: 12970489
- Regulation of storage protein gene expression in Arabidopsis. DOI: 10.1242/dev.00814 ; PMID: 14597573
- LEC1, FUS3, ABI3 and Em expression reveals no correlation with dormancy in Arabidopsis. DOI: 10.1093/jxb/erh014 ; PMID: 14676287
- The Arabidopsis thaliana ABSCISIC ACID-INSENSITIVE8 encodes a novel protein mediating abscisic acid and sugar responses essential for growth. DOI: 10.1105/tpc.018077 ; PMID: 14742875
- ABI3 mediates expression of the peroxiredoxin antioxidant AtPER1 gene and induction by oxidative stress. DOI: 10.1023/b:plan.0000006937.21343.2a ; PMID: 14750521
- LEAFY COTYLEDON1 controls seed storage protein genes through its regulation of FUSCA3 and ABSCISIC ACID INSENSITIVE3. DOI: 10.1093/pcp/pci048 ; PMID: 15695450
- An important role of phosphatidic acid in ABA signaling during germination in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2005.02431.x ; PMID: 15960620
- Analysis of a sugar response mutant of Arabidopsis identified a novel B3 domain protein that functions as an active transcriptional repressor. DOI: 10.1104/pp.104.057752 ; PMID: 15894743
- Phytochrome control of the Arabidopsis transcriptome anticipates seedling exposure to light. DOI: 10.1105/tpc.105.034322 ; PMID: 16024587
- and CBF/DREB1-regulated genes of Arabidopsis. DOI: 10.1104/pp.104.058412 ; PMID: 16113229
- LEAFY COTYLEDON 2 activation is sufficient to trigger the accumulation of oil and seed specific mRNAs in Arabidopsis leaves. DOI: 10.1016/j.febslet.2005.07.037 ; PMID: 16107256
- AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development. DOI: 10.1111/j.1365-313X.2005.02575.x ; PMID: 16359384
- Role of abscisic acid (ABA) and Arabidopsis thaliana ABA-insensitive loci in low water potential-induced ABA and proline accumulation. DOI: 10.1093/jxb/erj026 ; PMID: 16339784
- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis. DOI: 10.1007/s11103-005-2418-5 ; PMID: 16463099
- WRI1 is required for seed germination and seedling establishment. DOI: 10.1104/pp.106.079574 ; PMID: 16632590
- A network of local and redundant gene regulation governs Arabidopsis seed maturation. DOI: 10.1105/tpc.105.039925 ; PMID: 16731585
- Gene duplication, exon gain and neofunctionalization of OEP16-related genes in land plants. DOI: 10.1111/j.1365-313X.2006.02741.x ; PMID: 16709189
- Arabidopsis ABA INSENSITIVE4 regulates lipid mobilization in the embryo and reveals repression of seed germination by the endosperm. DOI: 10.1105/tpc.106.041277 ; PMID: 16844907
- Characterization and functional analysis of ABSCISIC ACID INSENSITIVE3-like genes from Physcomitrella patens. DOI: 10.1111/j.1365-313X.2006.02764.x ; PMID: 16805735
- The B2 domain of VIVIPAROUS1 is bi-functional and regulates nuclear localization and transactivation. DOI: 10.1007/s00425-006-0398-6 ; PMID: 16977453
- AKRP and EMB506 are two ankyrin repeat proteins essential for plastid differentiation and plant development in Arabidopsis. DOI: 10.1111/j.1365-313X.2006.02922.x ; PMID: 17092312
- Repression of the LEAFY COTYLEDON 1/B3 regulatory network in plant embryo development by VP1/ABSCISIC ACID INSENSITIVE 3-LIKE B3 genes. DOI: 10.1104/pp.106.092320 ; PMID: 17158584
- Abscisic acid antagonizes ethylene-induced hyponastic growth in Arabidopsis. DOI: 10.1104/pp.106.092700 ; PMID: 17158582
- A novel transcriptional cascade regulating expression of heat stress proteins during seed development of Arabidopsis. DOI: 10.1105/tpc.106.048165 ; PMID: 17220197
- ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. DOI: 10.1111/j.1365-313X.2006.02980.x ; PMID: 17217461
- Developmental control of Arabidopsis seed oil biosynthesis. DOI: 10.1007/s00425-007-0524-0 ; PMID: 17522888
- 14-3-3 Proteins are components of the transcription complex of the ATEM1 promoter in Arabidopsis. DOI: 10.1007/s00425-007-0604-1 ; PMID: 17701425
- The role of chromatin-remodeling factor PKL in balancing osmotic stress responses during Arabidopsis seed germination. DOI: 10.1111/j.1365-313X.2007.03288.x ; PMID: 17892443
- The Arabidopsis histone deacetylases HDA6 and HDA19 contribute to the repression of embryonic properties after germination. DOI: 10.1104/pp.107.111674 ; PMID: 18024558
- Combinatorial interactions of multiple cis-elements regulating the induction of the Arabidopsis XERO2 dehydrin gene by abscisic acid and cold. DOI: 10.1111/j.1365-313X.2007.03399.x ; PMID: 18088305
- Signaling pathways mediating the suppression of Arabidopsis thaliana Ku gene expression by abscisic acid. DOI: 10.1016/j.bbagrm.2007.12.005 ; PMID: 18179780
- Interaction between sugar and abscisic acid signalling during early seedling development in Arabidopsis. DOI: 10.1007/s11103-008-9308-6 ; PMID: 18278579
- Inventory, evolution and expression profiling diversity of the LEA (late embryogenesis abundant) protein gene family in Arabidopsis thaliana. DOI: 10.1007/s11103-008-9304-x ; PMID: 18265943
- Deciphering gene regulatory networks that control seed development and maturation in Arabidopsis. DOI: 10.1111/j.1365-313X.2008.03461.x ; PMID: 18476867
- Interactions between the S-domain receptor kinases and AtPUB-ARM E3 ubiquitin ligases suggest a conserved signaling pathway in Arabidopsis. DOI: 10.1104/pp.108.123380 ; PMID: 18552232
- Identification, cloning and characterization of sis7 and sis10 sugar-insensitive mutants of Arabidopsis. DOI: 10.1186/1471-2229-8-104 ; PMID: 18854047
- The Arabidopsis RING finger E3 ligase RHA2a is a novel positive regulator of abscisic acid signaling during seed germination and early seedling development. DOI: 10.1104/pp.109.135269 ; PMID: 19286935
- A nuclear gene encoding the iron-sulfur subunit of mitochondrial complex II is regulated by B3 domain transcription factors during seed development in Arabidopsis. DOI: 10.1104/pp.109.136531 ; PMID: 19261733
- The N-end rule pathway promotes seed germination and establishment through removal of ABA sensitivity in Arabidopsis. DOI: 10.1073/pnas.0810280106 ; PMID: 19255443
- Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy. DOI: 10.1093/pcp/pcp083 ; PMID: 19541597
- The transcription factor ABI4 is a regulator of mitochondrial retrograde expression of ALTERNATIVE OXIDASE1a. DOI: 10.1104/pp.109.139782 ; PMID: 19482916
- Abscisic acid regulates gene expression in cortical fiber cells and silica cells of rice shoots. DOI: 10.1111/j.1469-8137.2007.02365.x ; PMID: 18315698
- Transgenic expression of MYB15 confers enhanced sensitivity to abscisic acid and improved drought tolerance in Arabidopsis thaliana. DOI: 10.1016/S1673-8527(09)60003-5 ; PMID: 19161942
- Arabidopsis WRKY2 transcription factor mediates seed germination and postgermination arrest of development by abscisic acid. DOI: 10.1186/1471-2229-9-96 ; PMID: 19622176
- Arabidopsis seed germination responses to osmotic stress involve the chromatin modifier PICKLE. DOI: 10.4161/psb.3.7.5679 ; PMID: 19704491
- Epigenetic regulation of gene programs by EMF1 and EMF2 in Arabidopsis. DOI: 10.1104/pp.109.143495 ; PMID: 19783648
- Global identification of targets of the Arabidopsis MADS domain protein AGAMOUS-Like15. DOI: 10.1105/tpc.109.068890 ; PMID: 19767455
- Natural modifiers of seed longevity in the Arabidopsis mutants abscisic acid insensitive3-5 (abi3-5) and leafy cotyledon1-3 (lec1-3). DOI: 10.1111/j.1469-8137.2009.03023.x ; PMID: 19754639
- Cross-species approaches to seed dormancy and germination: conservation and biodiversity of ABA-regulated mechanisms and the Brassicaceae DOG1 genes. DOI: 10.1007/s11103-009-9583-x ; PMID: 20013031
- MOTHER OF FT AND TFL1 regulates seed germination through a negative feedback loop modulating ABA signaling in Arabidopsis. DOI: 10.1105/tpc.109.073072 ; PMID: 20551347
- AtTPS1-mediated trehalose 6-phosphate synthesis is essential for embryogenic and vegetative growth and responsiveness to ABA in germinating seeds and stomatal guard cells. DOI: 10.1111/j.1365-313X.2010.04312.x ; PMID: 20659274
- The plant-specific SR45 protein negatively regulates glucose and ABA signaling during early seedling development in Arabidopsis. DOI: 10.1104/pp.110.155523 ; PMID: 20699397
- Far-red light inhibits germination through DELLA-dependent stimulation of ABA synthesis and ABI3 activity. DOI: 10.1038/emboj.2009.170 ; PMID: 19556968
- ABI4 activates DGAT1 expression in Arabidopsis seedlings during nitrogen deficiency. DOI: 10.1104/pp.111.175950 ; PMID: 21515696
- The Arabidopsis RING finger E3 ligase RHA2b acts additively with RHA2a in regulating abscisic acid signaling and drought response. DOI: 10.1104/pp.111.176214 ; PMID: 21478367
- ABI3 and PIL5 collaboratively activate the expression of SOMNUS by directly binding to its promoter in imbibed Arabidopsis seeds. DOI: 10.1105/tpc.110.080721 ; PMID: 21467583
- Synergistic repression of the embryonic programme by SET DOMAIN GROUP 8 and EMBRYONIC FLOWER 2 in Arabidopsis seedlings. DOI: 10.1093/jxb/err383 ; PMID: 22162868
- Isolation and characterization of novel mutant loci suppressing the ABA hypersensitivity of the Arabidopsis coronatine insensitive 1-16 (coi1-16) mutant during germination and seedling growth. DOI: 10.1093/pcp/pcr174 ; PMID: 22156383
- The Arabidopsis mutant, fy-1, has an ABA-insensitive germination phenotype. DOI: 10.1093/jxb/err452 ; PMID: 22282534
- ASIL1 is required for proper timing of seed filling in Arabidopsis. DOI: 10.4161/psb.6.12.18709 ; PMID: 22231199
- Analysis of Arabidopsis glucose insensitive growth mutants reveals the involvement of the plastidial copper transporter PAA1 in glucose-induced intracellular signaling. DOI: 10.1104/pp.111.191726 ; PMID: 22582133
- Toward the identification and regulation of the Arabidopsis thaliana ABI3 regulon. DOI: 10.1093/nar/gks594 ; PMID: 22730287
- A novel abi5 allele reveals the importance of the conserved Ala in the C3 domain for regulation of downstream genes and salt tolerance during germination in Arabidopsis. DOI: 10.4161/psb.23455 ; PMID: 23299338
- Acyl-lipid metabolism. DOI: 10.1199/tab.0161 ; PMID: 23505340
- Temperature, light and nitrate sensing coordinate Arabidopsis seed dormancy cycling, resulting in winter and summer annual phenotypes. DOI: 10.1111/tpj.12186 ; PMID: 23590427
- BLH1 and KNAT3 modulate ABA responses during germination and early seedling development in Arabidopsis. DOI: 10.1111/tpj.12236 ; PMID: 23663178
- NFYA1 is involved in regulation of postgermination growth arrest under salt stress in Arabidopsis. DOI: 10.1371/journal.pone.0061289 ; PMID: 23637805
- and AtBMI1-mediated H2Aub initiate the switch from embryonic to postgerminative growth in Arabidopsis. DOI: 10.1016/j.cub.2013.05.050 ; PMID: 23810531
- Auxin controls seed dormancy through stimulation of abscisic acid signaling by inducing ARF-mediated ABI3 activation in Arabidopsis. DOI: 10.1073/pnas.1304651110 ; PMID: 23986496
- Involvement of microRNA-related regulatory pathways in the glucose-mediated control of Arabidopsis early seedling development. DOI: 10.1093/jxb/ert239 ; PMID: 23997203
- Distinct roles of LAFL network genes in promoting the embryonic seedling fate in the absence of VAL repression. DOI: 10.1104/pp.113.220988 ; PMID: 24043445
- Arabidopsis SAG protein containing the MDN1 domain participates in seed germination and seedling development by negatively regulating ABI3 and ABI5. DOI: 10.1093/jxb/ert343 ; PMID: 24163287
- Regulation of drought tolerance by the F-box protein MAX2 in Arabidopsis. DOI: 10.1104/pp.113.226837 ; PMID: 24198318
- Functional analyses of an E3 ligase gene AIP2 from wheat in Arabidopsis revealed its roles in seed germination and pre-harvest sprouting. DOI: 10.1111/jipb.12135 ; PMID: 24279988
- Arabidopsis AL PHD-PRC1 complexes promote seed germination through H3K4me3-to-H3K27me3 chromatin state switch in repression of seed developmental genes. DOI: 10.1371/journal.pgen.1004091 ; PMID: 24465219
- Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2) in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues. DOI: 10.1016/j.fob.2013.11.003 ; PMID: 24363987
- ABA-insensitive3, ABA-insensitive5, and DELLAs Interact to activate the expression of SOMNUS and other high-temperature-inducible genes in imbibed seeds in Arabidopsis. DOI: 10.1105/tpc.113.118604 ; PMID: 24326588
- Related to ABA-Insensitive3(ABI3)/Viviparous1 and AtABI5 transcription factor coexpression in cotton enhances drought stress adaptation. DOI: 10.1111/pbi.12162 ; PMID: 24483851
- ASCORBATE PEROXIDASE6 protects Arabidopsis desiccating and germinating seeds from stress and mediates cross talk between reactive oxygen species, abscisic acid, and auxin. DOI: 10.1104/pp.114.245324 ; PMID: 25049361
- Seed maturation regulators are related to the control of seed dormancy in wheat (Triticum aestivum L.). DOI: 10.1371/journal.pone.0107618 ; PMID: 25211528
- Cell-by-cell developmental transition from embryo to post-germination phase revealed by heterochronic gene expression and ER-body formation in Arabidopsis leafy cotyledon mutants. DOI: 10.1093/pcp/pcu139 ; PMID: 25282558
- Cloning of Gossypium hirsutum sucrose non-fermenting 1-related protein kinase 2 gene (GhSnRK2) and its overexpression in transgenic Arabidopsis escalates drought and low temperature tolerance. DOI: 10.1371/journal.pone.0112269 ; PMID: 25393623
- New cross talk between ROS, ABA and auxin controlling seed maturation and germination unraveled in APX6 deficient Arabidopsis seeds. DOI: 10.4161/15592324.2014.976489 ; PMID: 25482750
- Chromodomain, Helicase and DNA-binding CHD1 protein, CHR5, are involved in establishing active chromatin state of seed maturation genes. DOI: 10.1111/pbi.12315 ; PMID: 25581843
- Arabidopsis histone demethylases LDL1 and LDL2 control primary seed dormancy by regulating DELAY OF GERMINATION 1 and ABA signaling-related genes. DOI: 10.3389/fpls.2015.00159 ; PMID: 25852712
- Complementation of Seed Maturation Phenotypes by Ectopic Expression of ABSCISIC ACID INSENSITIVE3, FUSCA3 and LEAFY COTYLEDON2 in Arabidopsis. DOI: 10.1093/pcp/pcv049 ; PMID: 25840088
- Arabidopsis seed-specific vacuolar aquaporins are involved in maintaining seed longevity under the control of ABSCISIC ACID INSENSITIVE 3. DOI: 10.1093/jxb/erv244 ; PMID: 26019256
- CYCLIN-DEPENDENT KINASE G2 regulates salinity stress response and salt mediated flowering in Arabidopsis thaliana. DOI: 10.1007/s11103-015-0324-z ; PMID: 25948280
- OsTCP19 influences developmental and abiotic stress signaling by modulating ABI4-mediated pathways. DOI: 10.1038/srep09998 ; PMID: 25925167
- Identification of ICE1 as a negative regulator of ABA-dependent pathways in seeds and seedlings of Arabidopsis. DOI: 10.1007/s11103-015-0335-9 ; PMID: 26048037
- Ectopic expression of UGT75D1, a glycosyltransferase preferring indole-3-butyric acid, modulates cotyledon development and stress tolerance in seed germination of Arabidopsis thaliana. DOI: 10.1007/s11103-015-0395-x ; PMID: 26496910
- ABA-HYPERSENSITIVE BTB/POZ PROTEIN 1 functions as a negative regulator in ABA-mediated inhibition of germination in Arabidopsis. DOI: 10.1007/s11103-015-0418-7 ; PMID: 26667153
- The Arabidopsis DELAY OF GERMINATION 1 gene affects ABSCISIC ACID INSENSITIVE 5 (ABI5) expression and genetically interacts with ABI3 during Arabidopsis seed development. DOI: 10.1111/tpj.13118 ; PMID: 26729600
- Arabidopsis WRKY6 Transcription Factor Acts as a Positive Regulator of Abscisic Acid Signaling during Seed Germination and Early Seedling Development. DOI: 10.1371/journal.pgen.1005833 ; PMID: 26829043
- Deciphering the Molecular Mechanisms Underpinning the Transcriptional Control of Gene Expression by Master Transcriptional Regulators in Arabidopsis Seed. DOI: 10.1104/pp.16.00034 ; PMID: 27208266
- Deciphering and modifying LAFL transcriptional regulatory network in seed for improving yield and quality of storage compounds. DOI: 10.1016/j.plantsci.2016.06.013 ; PMID: 27457996
- ZRF1 Chromatin Regulators Have Polycomb Silencing and Independent Roles in Development. DOI: 10.1104/pp.16.00193 ; PMID: 27630184
- Overexpression of AtEDT1/HDG11 in Chinese Kale (Brassica oleracea var. alboglabra) Enhances Drought and Osmotic Stress Tolerance. DOI: 10.3389/fpls.2016.01285 ; PMID: 27625663
- The Arabidopsis heat-intolerant 5 (hit5)/enhanced response to aba 1 (era1) mutant reveals the crucial role of protein farnesylation in plant responses to heat stress. DOI: 10.1111/nph.14212 ; PMID: 27673599
- An RRM-containing mei2-like MCT1 plays a negative role in the seed germination and seedling growth of Arabidopsis thaliana in the presence of ABA. DOI: 10.1016/j.plaphy.2016.10.009 ; PMID: 27771580
- WRKY41 controls Arabidopsis seed dormancy via direct regulation of ABI3 transcript levels not downstream of ABA. DOI: 10.1111/tpj.12597 ; PMID: 24946881
- Control of early seedling development by BES1/TPL/HDA19-mediated epigenetic regulation of ABI3. DOI: 10.1038/ncomms5138 ; PMID: 24938150
- Two MYB-related transcription factors play opposite roles in sugar signaling in Arabidopsis. DOI: 10.1007/s11103-016-0562-8 ; PMID: 27866313
- A Novel RNA-Binding Protein Involves ABA Signaling by Post-transcriptionally Repressing ABI2. DOI: 10.3389/fpls.2017.00024 ; PMID: 28174577
- AtbHLH68 transcription factor contributes to the regulation of ABA homeostasis and drought stress tolerance in Arabidopsis thaliana. DOI: 10.1111/ppl.12549 ; PMID: 28369972
- Evolutionary Analysis of the LAFL Genes Involved in the Land Plant Seed Maturation Program. DOI: 10.3389/fpls.2017.00439 ; PMID: 28421087
- Abscisic acid signaling is involved in regulating the mitogen-activated protein kinase cascade module, AIK1-MKK5-MPK6. DOI: 10.1080/15592324.2017.1321188 ; PMID: 28494202
- Sinapic acid or its derivatives interfere with abscisic acid homeostasis during Arabidopsis thaliana seed germination. DOI: 10.1186/s12870-017-1048-9 ; PMID: 28587634
- Abscisic acid negatively regulates post-penetration resistance of Arabidopsis to the biotrophic powdery mildew fungus. DOI: 10.1007/s11427-017-9036-2 ; PMID: 28702742
- The BABY BOOM Transcription Factor Activates the LEC1-ABI3-FUS3-LEC2 Network to Induce Somatic Embryogenesis. DOI: 10.1104/pp.17.00232 ; PMID: 28830937
- Arabidopsis plants exposed to dioxin result in a WRINKLED seed phenotype due to 20S proteasomal degradation of WRI1. DOI: 10.1093/jxb/ery027 ; PMID: 29394403
- Glutamate Receptor Homolog3.4 is Involved in Regulation of Seed Germination Under Salt Stress in Arabidopsis. DOI: 10.1093/pcp/pcy034 ; PMID: 29432559
- HSI2/VAL1 Silences AGL15 to Regulate the Developmental Transition from Seed Maturation to Vegetative Growth in Arabidopsis. DOI: 10.1105/tpc.17.00655 ; PMID: 29475938
- GmRAV1 regulates regeneration of roots and adventitious buds by the cytokinin signaling pathway in Arabidopsis and soybean. DOI: 10.1111/ppl.12788 ; PMID: 29923201
- AtDIV2, an R-R-type MYB transcription factor of Arabidopsis, negatively regulates salt stress by modulating ABA signaling. DOI: 10.1007/s00299-018-2321-6 ; PMID: 30014159
- DNA recognition by Arabidopsis transcription factors ABI3 and NGA1. DOI: 10.1111/febs.14649 ; PMID: 30183137
- Genetic interactions between ABA signalling and the Arg/N-end rule pathway during Arabidopsis seedling establishment. DOI: 10.1038/s41598-018-33630-5 ; PMID: 30315202
- The C-terminal WD40 repeats on the TOPLESS co-repressor function as a protein-protein interaction surface. DOI: 10.1007/s11103-019-00842-w ; PMID: 30783952
- Abscisic acid-dependent histone demethylation during postgermination growth arrest in Arabidopsis. DOI: 10.1111/pce.13547 ; PMID: 30859592
- The onset of embryo maturation in Arabidopsis is determined by its developmental stage and does not depend on endosperm cellularization. DOI: 10.1111/tpj.14324 ; PMID: 30900325
- ABSCISIC ACID-INSENSITIVE 3 is involved in brassinosteroid-mediated regulation of flowering in plants. DOI: 10.1016/j.plaphy.2019.03.022 ; PMID: 30908972
- Basic LEUCINE ZIPPER TRANSCRIPTION FACTOR67 Transactivates DELAY OF GERMINATION1 to Establish Primary Seed Dormancy in Arabidopsis. DOI: 10.1105/tpc.18.00892 ; PMID: 30962396
- Powerdress as the novel regulator enhances Arabidopsis seeds germination tolerance to high temperature stress by histone modification of SOM locus. DOI: 10.1016/j.plantsci.2019.04.001 ; PMID: 31084884
- The Transcription Factor INDUCER OF CBF EXPRESSION1 Interacts with ABSCISIC ACID INSENSITIVE5 and DELLA Proteins to Fine-Tune Abscisic Acid Signaling during Seed Germination in Arabidopsis. DOI: 10.1105/tpc.18.00825 ; PMID: 31123050
- ARABIDOPSIS NITRATE REGULATED 1 acts as a negative modulator of seed germination by activating ABI3 expression. DOI: 10.1111/nph.16172 ; PMID: 31491809
- Arabidopsis Raf-Like Kinase Raf10 Is a Regulatory Component of Core ABA Signaling. DOI: 10.14348/molcells.2019.0173 ; PMID: 31480825
- The cysteine-rich receptor-like protein kinase CRK28 modulates Arabidopsis growth and development and influences abscisic acid responses. DOI: 10.1007/s00425-019-03296-y ; PMID: 31776759
- The Arabidopsis UDP-glycosyltransferase75B1, conjugates abscisic acid and affects plant response to abiotic stresses. DOI: 10.1007/s11103-019-00953-4 ; PMID: 31894456
- DRT111/SFPS Splicing Factor Controls Abscisic Acid Sensitivity during Seed Development and Germination. DOI: 10.1104/pp.20.00037 ; PMID: 32123040
- The Auxin Signaling Repressor IAA8 Promotes Seed Germination Through Down-Regulation of ABI3 Transcription in Arabidopsis. DOI: 10.3389/fpls.2020.00111 ; PMID: 32153614
- REVERSAL OF RDO5 1, a Homolog of Rice Seed Dormancy4, Interacts with bHLH57 and Controls ABA Biosynthesis and Seed Dormancy in Arabidopsis. DOI: 10.1105/tpc.20.00026 ; PMID: 32213638
- A selective autophagy cargo receptor NBR1 modulates abscisic acid signalling in Arabidopsis thaliana. DOI: 10.1038/s41598-020-64765-z ; PMID: 32385330
- Direct and indirect targets of the arabidopsis seed transcription factor ABSCISIC ACID INSENSITIVE3. DOI: 10.1111/tpj.14854 ; PMID: 32445409
- ABI3 mediated repression of RAV1 gene expression promotes efficient dehydration stress response in Arabidopsis thaliana. DOI: 10.1016/j.bbagrm.2020.194582 ; PMID: 32442719
- The AtGSTU7 gene influences glutathione-dependent seed germination under ABA and osmotic stress in Arabidopsis. DOI: 10.1016/j.bbrc.2020.05.153 ; PMID: 32507596
- Sequence analysis and protein interactions of Arabidopsis CIA2 and CIL proteins. DOI: 10.1186/s40529-020-00297-z ; PMID: 32556735
- ABI3 plays a role in de-novo root regeneration from Arabidopsis thaliana callus cells. DOI: 10.1080/15592324.2020.1794147 ; PMID: 32662721
- heterozygotes of Arabidopsis thaliana. DOI: 10.1080/15592324.2020.1780038 ; PMID: 32657242
- The OXA2a Insertase of Arabidopsis Is Required for Cytochrome c Maturation. DOI: 10.1104/pp.19.01248 ; PMID: 32759271
- Arabidopsis NRT1.2 interacts with the PHOSPHOLIPASE Dα1 (PLDα1) to positively regulate seed germination and seedling development in response to ABA treatment. DOI: 10.1016/j.bbrc.2020.08.025 ; PMID: 32933749
- Functional Characterization of a Putative RNA Demethylase ALKBH6 in Arabidopsis Growth and Abiotic Stress Responses. DOI: 10.3390/ijms21186707 ; PMID: 32933187
- Molecular Mechanism Underlying the Synergetic Effect of Jasmonate on Abscisic Acid Signaling during Seed Germination in Arabidopsis. DOI: 10.1105/tpc.19.00838 ; PMID: 33023956
- The Arabidopsis F-box protein FOF2 regulates ABA-mediated seed germination and drought tolerance. DOI: 10.1016/j.plantsci.2020.110643 ; PMID: 33218620
- Arabidopsis F-box protein At1g08710 interacts with transcriptional protein ADA2b and imparts drought stress tolerance by negatively regulating seedling growth. DOI: 10.1016/j.bbrc.2020.12.054 ; PMID: 33360542
- The metabolite methylglyoxal-mediated gene expression is associated with histone methylglyoxalation. DOI: 10.1093/nar/gkab014 ; PMID: 33476385
- A RanBP2-type zinc finger protein functions in intron splicing in Arabidopsis mitochondria and is involved in the biogenesis of respiratory complex I. DOI: 10.1093/nar/gkab066 ; PMID: 33660772
- ATHB2 is a negative regulator of germination in Arabidopsis thaliana seeds. DOI: 10.1038/s41598-021-88874-5 ; PMID: 33958633
- AtMYB32 regulates the ABA response by targeting ABI3, ABI4 and ABI5 and the drought response by targeting CBF4 in Arabidopsis. DOI: 10.1016/j.plantsci.2021.110983 ; PMID: 34315599
- Alpha-ketoglutarate-dependent dioxygenase homolog 10B, an N(6) -methyladenosine mRNA demethylase, plays a role in salt stress and abscisic acid responses in Arabidopsis thaliana. DOI: 10.1111/ppl.13505 ; PMID: 34309025
- Transcriptional regulation of plant seed development. DOI: 10.1111/ppl.13548 ; PMID: 34480800
- Arabidopsis LSH8 Positively Regulates ABA Signaling by Changing the Expression Pattern of ABA-Responsive Proteins. DOI: 10.3390/ijms221910314 ; PMID: 34638657
- Embryonic reactivation of FLOWERING LOCUS C by ABSCISIC ACID-INSENSITIVE 3 establishes the vernalization requirement in each Arabidopsis generation. DOI: 10.1093/plcell/koac077 ; PMID: 35234936
- Transcriptional control of Arabidopsis seed development. DOI: 10.1007/s00425-022-03870-x ; PMID: 35318532
- and PIF1-mediated regulation of GIG1 enhances seed germination by detoxification of methylglyoxal in Arabidopsis. DOI: 10.1111/tpj.15755 ; PMID: 35365944
- Abscisic acid negatively regulates the Polycomb-mediated H3K27me3 through the PHD-finger protein, VIL1. DOI: 10.1111/nph.18156 ; PMID: 35403701
- B3 Transcription Factors Determine Iron Distribution and FERRITIN Gene Expression in Embryo but Do Not Control Total Seed Iron Content. DOI: 10.3389/fpls.2022.870078 ; PMID: 35599858
- The F-Box/DUF295 Brassiceae specific 2 is involved in ABA-inhibited seed germination and seedling growth in Arabidopsis. DOI: 10.1016/j.plantsci.2022.111369 ; PMID: 35820550
- AtS40-1, a group I DUF584 protein positively regulates ABA response and salt tolerance in Arabidopsis. DOI: 10.1016/j.gene.2022.146846 ; PMID: 36044943
- The transcriptional co-repressor SEED DORMANCY 4-LIKE (AtSDR4L) promotes the embryonic-to-vegetative transition in Arabidopsis thaliana. DOI: 10.1111/jipb.13360 ; PMID: 36083579
- The RNA N(6) -methyladenosine demethylase ALKBH9B modulates ABA responses in Arabidopsis. DOI: 10.1111/jipb.13394 ; PMID: 36263999
- U-box E3 ubiquitin ligase PUB8 attenuates abscisic acid responses during early seedling growth. DOI: 10.1093/plphys/kiad044 ; PMID: 36715300
- Regulation of drought tolerance in Arabidopsis involves the PLATZ4-mediated transcriptional repression of plasma membrane aquaporin PIP2;8. DOI: 10.1111/tpj.16235 ; PMID: 37025007
- Arabidopsis EIN2 represses ABA responses during germination and early seedling growth by inactivating HLS1 protein independently of the canonical ethylene pathway. DOI: 10.1111/tpj.16335 ; PMID: 37269223
- Histone Deacetylases Regulate MORE AXILLARY BRANCHED 2-Dependent Germination of Arabidopsis thaliana. DOI: 10.1093/pcp/pcad047 ; PMID: 37279553
- A genomic perspective on plant transcription factors. DOI: 10.1016/s1369-5266(00)00107-2 ; PMID: 11019812
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Deciphering gene regulatory networks that control seed development and maturation in Arabidopsis. DOI: 10.1111/j.1365-313X.2008.03461.x ; PMID: 18476867
Sequence:
cDNA Sequence
- >AT3G24650.1 GAAAGAAAGAGAGAGTCTTCTTGTTGGAGTAAACCCAAACGGTTTTAGATTACTTATTAGCTGTTCATCAGTTCTTCCTCTCTAAAAGAGTAAAACCTAAACATCTCTCTCTGTTCTATTAGAACCAAAGACCAATCTTTGTGAACAAAACACATCTCGTATACTTCAGATCTAGACTCGAAAATTTTAGACCTCTTTACAATTGGTCTTTGTTCATCTGAAGTTGGAGAAAATAGTTAGCTTAGGTCGGATCTTTTCATATGCTTTGGATCCTCCTTCGTCTCTTTTGTATAATTTTAACCTTATCAAGAGTTCTTTTTGAATCTCAAAAGATTATATAGTAGTATAGAAGGTTTATATGTATATGTATAGCCAGATAGTTTATGTTGTTTAAAGATTCGATGATAGCCAAGTTGGGTTAACTTTCTTTTTCCTTGCCTCCTTACTCACATACAAACCCTATCTGTCCGTACAAAATACTAAAAACCCTAACTTTTCTCTCTCCACCAATCTAGTTTATTGTTTCATTTCCACTTCAACGATGAAAAGCTTGCATGTGGCGGCCAACGCCGGAGATCTGGCTGAGGATTGTGGAATACTCGGTGGAGACGCTGATGATACTGTTTTGATGGATGGAATTGATGAAGTTGGTAGAGAGATCTGGTTAGATGACCATGGAGGAGATAATAATCATGTTCATGGTCATCAAGATGATGATTTGATTGTTCATCATGACCCTTCAATCTTCTATGGAGATCTCCCAACGCTTCCTGATTTCCCATGCATGTCGTCTTCATCATCGTCTTCAACATCTCCAGCTCCTGTCAACGCAATCGTCTCCTCAGCCTCTTCTTCTTCGGCAGCTTCTTCCTCCACTTCCTCAGCTGCTTCTTGGGCTATATTGAGATCAGATGGAGAAGATCCGACTCCAAACCAAAACCAATACGCATCAGGAAACTGTGACGACTCTTCTGGTGCATTGCAATCCACAGCTTCCATGGAGATTCCATTAGACAGCAGTCAAGGTTTTGGTTGCGGCGAAGGCGGTGGTGATTGCATTGATATGATGGAGACTTTCGGGTACATGGATCTACTTGATAGCAACGAGTTCTTTGACACCTCAGCTATATTTAGCCAAGACGACGACACGCAAAACCCTAACTTGATGGACCAAACCCTTGAGAGACAAGAAGACCAGGTCGTTGTTCCGATGATGGAGAATAACAGTGGTGGAGACATGCAAATGATGAATTCTTCCTTGGAACAGGACGATGATCTCGCTGCTGTGTTTTTGGAGTGGCTAAAGAACAACAAGGAGACTGTGTCGGCTGAGGATTTGAGGAAAGTAAAGATAAAGAAAGCTACGATTGAATCAGCGGCAAGAAGACTAGGCGGTGGTAAAGAAGCGATGAAGCAGCTTTTAAAGCTGATTCTTGAATGGGTCCAAACTAATCACTTACAAAGAAGACGCACCACCACCACCACCACCAACCTCTCTTATCAACAATCATTCCAACAAGATCCATTTCAAAACCCTAACCCTAATAACAACAACCTAATCCCACCGTCCGACCAAACCTGTTTCTCACCTTCAACATGGGTTCCTCCACCACCACAACAACAAGCTTTTGTCTCGGACCCGGGTTTTGGATACATGCCTGCTCCAAACTATCCGCCACAGCCAGAGTTCCTTCCTTTACTTGAATCTCCACCGTCATGGCCACCACCACCACAGTCTGGTCCCATGCCACATCAACAATTCCCCATGCCGCCAACCTCGCAGTATAATCAATTTGGAGATCCAACAGGTTTCAATGGATACAACATGAATCCGTACCAATATCCTTATGTTCCTGCAGGACAAATGAGAGATCAGAGATTACTCCGTTTGTGTTCCTCAGCAACTAAAGAGGCAAGAAAGAAACGGATGGCGAGACAGAGGAGGTTCTTGTCTCATCACCACAGACATAACAACAACAACAACAACAACAACAATAATCAGCAGAACCAAACCCAAATCGGAGAAACCTGTGCCGCGGTGGCTCCACAACTTAACCCCGTGGCCACAACCGCCACGGGAGGGACCTGGATGTATTGGCCTAATGTCCCGGCAGTGCCGCCTCAATTACCGCCAGTGATGGAGACTCAGTTACCTACCATGGACCGAGCTGGCTCAGCTTCTGCTATGCCACGTCAGCAGGTGGTACCAGATCGCCGGCAGGGATGGAAACCAGAAAAGAATTTGCGGTTTCTCTTGCAGAAAGTCTTGAAGCAAAGCGACGTGGGTAACCTCGGAAGGATCGTTTTGCCAAAAAAAGAAGCTGAGACACACTTGCCGGAGCTAGAGGCAAGAGACGGCATCTCTCTGGCCATGGAAGACATCGGAACCTCTCGTGTTTGGAACATGCGCTACAGGTTTTGGCCTAACAACAAAAGCAGGATGTATCTCCTCGAGAACACCGGCGATTTTGTGAAAACCAATGGGCTCCAAGAAGGTGATTTCATAGTCATATACTCCGACGTCAAATGTGGCAAATATTTGATACGAGGGGTTAAAGTAAGACAACCGAGCGGACAAAAGCCGGAGGCCCCACCGTCGTCAGCAGCTACGAAGAGACAAAACAAGTCGCAAAGGAACATAAACAATAACTCTCCGTCGGCGAATGTGGTGGTCGCTTCACCAACTTCTCAAACTGTTAAATGAAAAACAGAGACAAAAAGAAACAATATAAATATTATTATGTACCAAATAAGAAAGAGGGCAAAAGGAAAAAATGGCAGCGTACCCGAGTGTGCCACTTCTCGTGCATGCATGGGATCTTGAAGACAAATGGAGGGTCATGATTAAAGCTGTTTGGTCGGGGTCCGGGTTTTTACTCCATTTTTTGCTTTTTCTTGTCGAGTCGGTTCTTTTATAACTCTTTACTCTTTTTACCTTCAGGATATTGTAGAGATGATTAATTCTGGAAATGGTGTTTGTGTTATATTTCTGGAGAGATGATTATATAGTTCTTTTGTTGTTGTAATTGGTTAATATTACATATGTGGCTCATTTCTTGAGTCGAGCTTACATATCGTTTATAATGTGAATGTTTTAAGAAGAGTTGAA
CDS Sequence
- >AT3G24650.1 ATGAAAAGCTTGCATGTGGCGGCCAACGCCGGAGATCTGGCTGAGGATTGTGGAATACTCGGTGGAGACGCTGATGATACTGTTTTGATGGATGGAATTGATGAAGTTGGTAGAGAGATCTGGTTAGATGACCATGGAGGAGATAATAATCATGTTCATGGTCATCAAGATGATGATTTGATTGTTCATCATGACCCTTCAATCTTCTATGGAGATCTCCCAACGCTTCCTGATTTCCCATGCATGTCGTCTTCATCATCGTCTTCAACATCTCCAGCTCCTGTCAACGCAATCGTCTCCTCAGCCTCTTCTTCTTCGGCAGCTTCTTCCTCCACTTCCTCAGCTGCTTCTTGGGCTATATTGAGATCAGATGGAGAAGATCCGACTCCAAACCAAAACCAATACGCATCAGGAAACTGTGACGACTCTTCTGGTGCATTGCAATCCACAGCTTCCATGGAGATTCCATTAGACAGCAGTCAAGGTTTTGGTTGCGGCGAAGGCGGTGGTGATTGCATTGATATGATGGAGACTTTCGGGTACATGGATCTACTTGATAGCAACGAGTTCTTTGACACCTCAGCTATATTTAGCCAAGACGACGACACGCAAAACCCTAACTTGATGGACCAAACCCTTGAGAGACAAGAAGACCAGGTCGTTGTTCCGATGATGGAGAATAACAGTGGTGGAGACATGCAAATGATGAATTCTTCCTTGGAACAGGACGATGATCTCGCTGCTGTGTTTTTGGAGTGGCTAAAGAACAACAAGGAGACTGTGTCGGCTGAGGATTTGAGGAAAGTAAAGATAAAGAAAGCTACGATTGAATCAGCGGCAAGAAGACTAGGCGGTGGTAAAGAAGCGATGAAGCAGCTTTTAAAGCTGATTCTTGAATGGGTCCAAACTAATCACTTACAAAGAAGACGCACCACCACCACCACCACCAACCTCTCTTATCAACAATCATTCCAACAAGATCCATTTCAAAACCCTAACCCTAATAACAACAACCTAATCCCACCGTCCGACCAAACCTGTTTCTCACCTTCAACATGGGTTCCTCCACCACCACAACAACAAGCTTTTGTCTCGGACCCGGGTTTTGGATACATGCCTGCTCCAAACTATCCGCCACAGCCAGAGTTCCTTCCTTTACTTGAATCTCCACCGTCATGGCCACCACCACCACAGTCTGGTCCCATGCCACATCAACAATTCCCCATGCCGCCAACCTCGCAGTATAATCAATTTGGAGATCCAACAGGTTTCAATGGATACAACATGAATCCGTACCAATATCCTTATGTTCCTGCAGGACAAATGAGAGATCAGAGATTACTCCGTTTGTGTTCCTCAGCAACTAAAGAGGCAAGAAAGAAACGGATGGCGAGACAGAGGAGGTTCTTGTCTCATCACCACAGACATAACAACAACAACAACAACAACAACAATAATCAGCAGAACCAAACCCAAATCGGAGAAACCTGTGCCGCGGTGGCTCCACAACTTAACCCCGTGGCCACAACCGCCACGGGAGGGACCTGGATGTATTGGCCTAATGTCCCGGCAGTGCCGCCTCAATTACCGCCAGTGATGGAGACTCAGTTACCTACCATGGACCGAGCTGGCTCAGCTTCTGCTATGCCACGTCAGCAGGTGGTACCAGATCGCCGGCAGGGATGGAAACCAGAAAAGAATTTGCGGTTTCTCTTGCAGAAAGTCTTGAAGCAAAGCGACGTGGGTAACCTCGGAAGGATCGTTTTGCCAAAAAAAGAAGCTGAGACACACTTGCCGGAGCTAGAGGCAAGAGACGGCATCTCTCTGGCCATGGAAGACATCGGAACCTCTCGTGTTTGGAACATGCGCTACAGGTTTTGGCCTAACAACAAAAGCAGGATGTATCTCCTCGAGAACACCGGCGATTTTGTGAAAACCAATGGGCTCCAAGAAGGTGATTTCATAGTCATATACTCCGACGTCAAATGTGGCAAATATTTGATACGAGGGGTTAAAGTAAGACAACCGAGCGGACAAAAGCCGGAGGCCCCACCGTCGTCAGCAGCTACGAAGAGACAAAACAAGTCGCAAAGGAACATAAACAATAACTCTCCGTCGGCGAATGTGGTGGTCGCTTCACCAACTTCTCAAACTGTTAAATGA
Protein Sequence
- >AT3G24650.1 MKSLHVAANAGDLAEDCGILGGDADDTVLMDGIDEVGREIWLDDHGGDNNHVHGHQDDDLIVHHDPSIFYGDLPTLPDFPCMSSSSSSSTSPAPVNAIVSSASSSSAASSSTSSAASWAILRSDGEDPTPNQNQYASGNCDDSSGALQSTASMEIPLDSSQGFGCGEGGGDCIDMMETFGYMDLLDSNEFFDTSAIFSQDDDTQNPNLMDQTLERQEDQVVVPMMENNSGGDMQMMNSSLEQDDDLAAVFLEWLKNNKETVSAEDLRKVKIKKATIESAARRLGGGKEAMKQLLKLILEWVQTNHLQRRRTTTTTTNLSYQQSFQQDPFQNPNPNNNNLIPPSDQTCFSPSTWVPPPPQQQAFVSDPGFGYMPAPNYPPQPEFLPLLESPPSWPPPPQSGPMPHQQFPMPPTSQYNQFGDPTGFNGYNMNPYQYPYVPAGQMRDQRLLRLCSSATKEARKKRMARQRRFLSHHHRHNNNNNNNNNNQQNQTQIGETCAAVAPQLNPVATTATGGTWMYWPNVPAVPPQLPPVMETQLPTMDRAGSASAMPRQQVVPDRRQGWKPEKNLRFLLQKVLKQSDVGNLGRIVLPKKEAETHLPELEARDGISLAMEDIGTSRVWNMRYRFWPNNKSRMYLLENTGDFVKTNGLQEGDFIVIYSDVKCGKYLIRGVKVRQPSGQKPEAPPSSAATKRQNKSQRNINNNSPSANVVVASPTSQTVK