Gene Details:
- Gene ID: AT4G16110
- Gene Symbol: ARR2, RR2
- Gene Name: response regulator 2, response regulator 2
- Description: response regulator 2;(source:Araport11)
- TAIR Accession: locus:2130095
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000025 — root tip — punta de la raíz (Spanish, exact), 根端 (Japanese, exact)
- PO:0000036 — leaf vascular system — sistema vascular de la hoja (Spanish, exact), 葉維管系 (Japanese, exact), leaf venation (related)
- PO:0000282 — trichome — tricoma (Spanish, exact), 毛茸、糸状体、毛 (Japanese, exact), seta (related), setae (related), capilli (narrow), capillus (narrow), cilia (narrow), cilium (narrow), glochid (narrow), glochidia (narrow), glochidium (narrow), hair (narrow), lepides (narrow), lepis (narrow), non-secretory trichome (narrow), scale (narrow), squama (narrow), squamae (narrow), squamella (narrow), squamellae (narrow), squamule (narrow), barb trichome (broad), bristle (broad)
- PO:0005660 — hydathode — hidatodo (Spanish, exact), 排水組織 (Japanese, exact)
- PO:0006079 — shoot system meristem — meristema del epiblasto (epiblastema) (Spanish, exact), シュート分裂組織 (Japanese, exact)
- PO:0006339 — juvenile vascular leaf — hoja juvenil (Spanish, exact), 維管束系幼葉 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Gene Ontology:
- GO:0010150 — involved in — leaf senescence
- GO:0080113 — acts upstream of or within — regulation of seed growth
- GO:0048364 — acts upstream of or within — root development
- GO:0010082 — acts upstream of or within — regulation of root meristem growth
- GO:0009735 — acts upstream of or within — response to cytokinin
- GO:0005515 — enables — protein binding
- GO:0009873 — acts upstream of or within — ethylene-activated signaling pathway
- GO:0009736 — acts upstream of or within — cytokinin-activated signaling pathway
- GO:0005634 — located in — nucleus
- GO:0010150 — acts upstream of or within — leaf senescence
- GO:0071368 — acts upstream of or within — cellular response to cytokinin stimulus
- GO:0009723 — acts upstream of or within — response to ethylene
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0000156 — enables — phosphorelay response regulator activity
- GO:0005829 — located in — cytosol
- GO:0010119 — acts upstream of or within — regulation of stomatal movement
Function-related keywords:
- root tip , leaf vascular system , trichome , hydathode , shoot system meristem , juvenile vascular leaf , root , pollen tube cell , pollen
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Two types of putative nuclear factors that physically interact with histidine-containing phosphotransfer (Hpt) domains, signaling mediators in His-to-Asp phosphorelay, in Arabidopsis thaliana. DOI: 10.1093/pcp/pce011 ; PMID: 11158442
- Two-component circuitry in Arabidopsis cytokinin signal transduction. DOI: 10.1038/35096500 ; PMID: 11574878
- Two-component signal transduction pathways in Arabidopsis. DOI: 10.1104/pp.005504 ; PMID: 12068096
- In vivo and in vitro characterization of the ARR11 response regulator implicated in the His-to-Asp phosphorelay signal transduction in Arabidopsis thaliana. DOI: 10.1093/pcp/pcg014 ; PMID: 12610214
- Expression profiling of cytokinin action in Arabidopsis. DOI: 10.1104/pp.103.021436 ; PMID: 12913156
- Comparative studies on the type-B response regulators revealing their distinctive properties in the His-to-Asp phosphorelay signal transduction of Arabidopsis thaliana. DOI: 10.1093/pcp/pcg154 ; PMID: 14749483
- Type-B response regulators display overlapping expression patterns in Arabidopsis. DOI: 10.1104/pp.103.038109 ; PMID: 15173562
- The response regulator 2 mediates ethylene signalling and hormone signal integration in Arabidopsis. DOI: 10.1038/sj.emboj.7600337 ; PMID: 15282545
- Multiple type-B response regulators mediate cytokinin signal transduction in Arabidopsis. DOI: 10.1105/tpc.105.035451 ; PMID: 16227453
- Cytokinin-mediated control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis. DOI: 10.1073/pnas.0505150103 ; PMID: 16407152
- Ethylene-induced stomatal closure in Arabidopsis occurs via AtrbohF-mediated hydrogen peroxide synthesis. DOI: 10.1111/j.1365-313X.2006.02842.x ; PMID: 16961732
- Three type-B response regulators, ARR1, ARR10 and ARR12, play essential but redundant roles in cytokinin signal transduction throughout the life cycle of Arabidopsis thaliana. DOI: 10.1093/pcp/pcm165 ; PMID: 18037673
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Acquiring competence for shoot development in Arabidopsis: ARR2 directly targets A-type ARR genes that are differentially activated by CIM preincubation. DOI: 10.4161/psb.3.2.4958 ; PMID: 19704721
- The cytokinin-activated transcription factor ARR2 promotes plant immunity via TGA3/NPR1-dependent salicylic acid signaling in Arabidopsis. DOI: 10.1016/j.devcel.2010.07.011 ; PMID: 20708590
- Manipulation of hemoglobin expression affects Arabidopsis shoot organogenesis. DOI: 10.1016/j.plaphy.2011.06.005 ; PMID: 21741261
- Functional identification of OsHk6 as a homotypic cytokinin receptor in rice with preferential affinity for iP. DOI: 10.1093/pcp/pcs079 ; PMID: 22642989
- Functional characterization of type-B response regulators in the Arabidopsis cytokinin response. DOI: 10.1104/pp.112.208736 ; PMID: 23482873
- Cytokinin inhibition of leaf senescence. DOI: 10.4161/psb.24737 ; PMID: 23656876
- Cytokinins control endocycle onset by promoting the expression of an APC/C activator in Arabidopsis roots. DOI: 10.1016/j.cub.2013.07.051 ; PMID: 24035544
- Heterotrimeric G protein mediates ethylene-induced stomatal closure via hydrogen peroxide synthesis in Arabidopsis. DOI: 10.1111/tpj.12799 ; PMID: 25704455
- Cytokinin-Mediated Regulation of Reactive Oxygen Species Homeostasis Modulates Stomatal Immunity in Arabidopsis. DOI: 10.1105/tpc.16.00583 ; PMID: 28254779
- A Two-Step Model for de Novo Activation of WUSCHEL during Plant Shoot Regeneration. DOI: 10.1105/tpc.16.00863 ; PMID: 28389585
- Type-B ARABIDOPSIS RESPONSE REGULATORs Specify the Shoot Stem Cell Niche by Dual Regulation of WUSCHEL. DOI: 10.1105/tpc.16.00640 ; PMID: 28576846
- Type-B ARABIDOPSIS RESPONSE REGULATORs Directly Activate WUSCHEL. DOI: 10.1016/j.tplants.2017.08.007 ; PMID: 28886911
- Actin Reorganization Triggers Rapid Cell Elongation in Roots. DOI: 10.1104/pp.18.00557 ; PMID: 30185441
- Ethylene mediates salicylic-acid-induced stomatal closure by controlling reactive oxygen species and nitric oxide production in Arabidopsis. DOI: 10.1016/j.plantsci.2020.110464 ; PMID: 32234220
- Root-derived trans-zeatin cytokinin protects Arabidopsis plants against photoperiod stress. DOI: 10.1111/pce.13860 ; PMID: 32716064
- The pre-mRNA splicing factor RDM16 regulates root stem cell maintenance in Arabidopsis. DOI: 10.1111/jipb.13006 ; PMID: 32790237
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Two-component circuitry in Arabidopsis cytokinin signal transduction. DOI: 10.1038/35096500 ; PMID: 11574878
- Two-component signal transduction pathways in Arabidopsis. DOI: 10.1104/pp.005504 ; PMID: 12068096
Sequence:
cDNA Sequence
- >AT4G16110.1 ACTTCAAAAAAAGAAATGTAACAGAGAAATCCGAGCTTTCAAGCTGTGAAACAATAGCCATGCCCTTCATAAATCTTTCTACTAATTATTTTTTTTCACGTAAGATTCTCAAAACAAATCAAAATCTCATCTTCTTGGTATCAAAAATTTTCTTACTTTTTTTGGTTTTGTTATCCCGAATTTTTAGAATCAAAACCCACGTCAATTCTTTTTCAAAGGCATATATTCTCTCTGTTTCAAACTTTGTGTCTCTTCTTCTCCTTCTCTGATCGTTCGTTTTCTGGACGAGAGAGATGGTAAATCCGGGTCACGGAAGAGGACCCGATTCGGGTACTGCTGCTGGTGGGTCAAACTCCGACCCGTTTCCTGCGAATCTTCGAGTTCTTGTCGTTGATGATGATCCAACTTGTCTCATGATCTTAGAGAGGATGCTTATGACTTGTCTCTACAGAGTAACTAAATGTAACAGAGCAGAGAGCGCATTGTCTCTGCTTCGGAAGAACAAGAATGGTTTTGATATTGTCATTAGTGATGTTCATATGCCTGACATGGATGGTTTCAAGCTCCTTGAACACGTTGGTTTAGAGATGGATTTACCTGTTATCATGATGTCTGCGGATGATTCGAAGAGCGTTGTGTTGAAAGGAGTGACTCACGGTGCAGTTGATTACCTCATCAAACCGGTACGTATTGAGGCTTTGAAGAATATATGGCAACATGTGGTGCGGAAGAAGCGTAACGAGTGGAATGTTTCTGAACATTCTGGAGGAAGTATTGAAGATACTGGCGGTGACAGGGACAGGCAGCAGCAGCATAGGGAGGATGCTGATAACAACTCGTCTTCAGTTAATGAAGGGAACGGGAGGAGCTCGAGGAAGCGGAAGGAAGAGGAAGTAGATGATCAAGGGGATGATAAGGAAGACTCATCGAGTTTAAAGAAACCACGCGTGGTTTGGTCTGTTGAATTGCATCAGCAGTTTGTTGCTGCTGTGAATCAGCTAGGCGTTGACAAAGCTGTTCCTAAGAAGATCTTAGAGATGATGAATGTACCCGGCTAACGCGAGAAAACGTAGCCAGTCACCTCCAGAAGTATCGGATATATCTGAGACGGCTTGGAGGAGTATCGCAACACCAAGGAAATATGAACCATTCGTTTATGACTGGTCAAGATCAGAGTTTTGGACCTCTTTCTTCGTTGAATGGATTTGATCTTCAATCTTTAGCTGTTACTGGTCAGCTCCCTCCTCAGAGCCTTGCACAGCTTCAAGCAGCTGGTCTTGGCCGGCCTACACTCGCTAAACCAGGGATGTCGGTTTCTCCCCTTGTAGATCAGAGAAGCATCTTCAACTTTGAAAACCCAAAAATAAGATTTGGAGACGGACATGGTCAGACGATGAACAATGGAAATTTGCTTCATGGTGTCCCAACGGGTAGTCACATGCGTCTGCGTCCTGGACAGAATGTTCAGAGCAGCGGAATGATGTTGCCAGTAGCAGACCAGCTACCTCGAGGAGGACCATCGATGCTACCATCCCTCGGGCAACAGCCGATATTGTCAAGCAGCGTTTCAAGAAGAAGCGATCTCACTGGTGCGCTGGCGGTTAGAAACAGTATCCCCGAGACCAACAGCAGAGTGTTACCAACTACTCACTCGGTCTTCAATAACTTCCCCGCGGATCTACCTCGCAGCAGCTTCCCGTTGGCAAGTGCCCCAGGGATTTCAGTTCCAGTATCAGTTTCTTACCAAGAAGAGGTCAACAGCTCGGATGCAAAAGGAGGTTCATCAGCTGCTACTGCTGGATTTGGTAACCCAAGCTACGACATATTTAACGATTTTCCGCAGCACCAACAGCACAACAAGAACATCAGCAATAAACTAAACGATTGGGATCTGCGGAATATGGGATTGGTCTTCAGTTCCAATCAGGACGCAGCAACTGCAACCGCAACCGCAGCATTTTCCACTTCGGAAGCATACTCTTCGTCTTCTACGCAGAGAAAAAGACGGGAAACGGACGCAACAGTTGTGGGTGAGCATGGGCAGAACCTGCAGTCACCGAGCCGGAATCTGTATCATCTGAACCACGTTTTTATGGACGGTGGTTCAGTCAGAGTGAAGTCAGAAAGAGTGGCGGAGACAGTGACTTGTCCTCCAGCAAATACATTGTTTCACGAGCAGTATAATCAAGAAGATCTGATGAGCGCATTTCTCAAACAGGAAGGCATCCCATCCGTAGATAACGAGTTCGAATTTGACGGATACTCCATCGATAATATCCAGGTCTGACTACAGAAACTCAGACTAGACTGCAAGATTCTTTGTTTTTCTTCTCCCTCCTTCGAGGTACAAAGCTCAAAACATGGCAATAACCGAAGGGAAAGATAGAAACGATCATGTGTTGTATCTTTAGATGATAATCTGCAGGAAATTCCAAAAGCAGGTTTTAGAAGACAATAATTGTTTTCTTTTTGGTTATTAGGAGTAATGTGAATTTCCTTGTTTCTACATCTGTCTAGGTCTTACAACAAGACTCTTGACATTTAGGGTTCTTGATCGTCTAATTTCCTATAATTAGAAATGTTTTGCTTCTCTCTTTTTGAGTTTTAGGAACATTTTGTGTAAATATGTTTCTATGCGTTGTTGCTTCATAATAATAAAGATACGG
CDS Sequence
Protein Sequence