Gene Details:
- Gene ID: AT4G18040
- Gene Symbol: AT.EIF4E1, CUM1, EIF4E, eIF4E1
- Gene Name: ARABIDOPSIS THALIANA EUKARYOTIC TRANSLATION INITATION FACTOR 4E1, CUCUMOVIRUS MULTIPLICATION 1, eukaryotic translation initiation factor 4E, eukaryotic translation Initiation Factor 4E1
- Description: eukaryotic translation initiation factor 4E;(source:Araport11)
- TAIR Accession: locus:2117647
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0005515 — enables — protein binding
- GO:0003743 — enables — translation initiation factor activity
- GO:0009615 — acts upstream of or within — response to virus
- GO:0010494 — located in — cytoplasmic stress granule
- GO:0000339 — enables — RNA cap binding
- GO:0016281 — part of — eukaryotic translation initiation factor 4F complex
- GO:0006413 — acts upstream of or within — translational initiation
- GO:0005845 — part of — mRNA cap binding complex
- GO:0005829 — located in — cytosol
- GO:0000932 — located in — P-body
- GO:0000340 — enables — RNA 7-methylguanosine cap binding
- GO:0005634 — located in — nucleus
- GO:0005737 — located in — cytoplasm
- GO:0005730 — located in — nucleolus
Function-related keywords:
Literature:
- The Arabidopsis cucumovirus multiplication 1 and 2 loci encode translation initiation factors 4E and 4G. DOI: 10.1128/JVI.78.12.6102-6111.2004 ; PMID: 15163703
- High-throughput protein localization in Arabidopsis using Agrobacterium-mediated transient expression of GFP-ORF fusions. DOI: 10.1111/j.1365-313X.2004.02281.x ; PMID: 15610358
- Translation initiation factors: a weak link in plant RNA virus infection. DOI: 10.1016/j.tplants.2005.11.004 ; PMID: 16343979
- Proteomic analysis and extensive protein identification from dry, germinating Arabidopsis seeds and young seedlings. DOI: 10.5483/bmbrep.2005.38.6.650 ; PMID: 16336779
- Coordinated and selective recruitment of eIF4E and eIF4G factors for potyvirus infection in Arabidopsis thaliana. DOI: 10.1016/j.febslet.2007.02.007 ; PMID: 17316629
- Toc64/OEP64 is not essential for the efficient import of proteins into chloroplasts in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2007.03207.x ; PMID: 17655652
- Selective recruitment of proteins to 5' cap complexes during the growth cycle in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.03882.x ; PMID: 19453450
- Deletion of the eIFiso4G subunit of the Arabidopsis eIFiso4F translation initiation complex impairs health and viability. DOI: 10.1007/s11103-010-9670-z ; PMID: 20694742
- Translation initiation factor AteIF(iso)4E is involved in selective mRNA translation in Arabidopsis thaliana seedlings. DOI: 10.1371/journal.pone.0031606 ; PMID: 22363683
- Five eIF4E isoforms from Arabidopsis thaliana are characterized by distinct features of cap analogs binding. DOI: 10.1016/j.bbrc.2014.11.032 ; PMID: 25446076
- Tudor staphylococcal nuclease links formation of stress granules and processing bodies with mRNA catabolism in Arabidopsis. DOI: 10.1105/tpc.114.134494 ; PMID: 25736060
- MRF Family Genes Are Involved in Translation Control, Especially under Energy-Deficient Conditions, and Their Expression and Functions Are Modulated by the TOR Signaling Pathway. DOI: 10.1105/tpc.17.00563 ; PMID: 29084871
- Plant growth and fertility requires functional interactions between specific PABP and eIF4G gene family members. DOI: 10.1371/journal.pone.0191474 ; PMID: 29381712
- Discovery and characterization of conserved binding of eIF4E 1 (CBE1), a eukaryotic translation initiation factor 4E-binding plant protein. DOI: 10.1074/jbc.RA118.003945 ; PMID: 30213859
- The RALF1-FERONIA Complex Phosphorylates eIF4E1 to Promote Protein Synthesis and Polar Root Hair Growth. DOI: 10.1016/j.molp.2019.12.014 ; PMID: 31904511
- Autocrine regulation of root hair size by the RALF-FERONIA-RSL4 signaling pathway. DOI: 10.1111/nph.16497 ; PMID: 32083740
Sequence:
cDNA Sequence
- >AT4G18040.1 CCCTACGAGAGGAAGTACATTAGTTTGGAGAAGAGTAATAGACAGAGAGATAGAGAGAAAGAGAAGCAGTTCGGAGAAACAATGGCGGTAGAAGACACTCCCAAATCTGTTGTAACGGAAGAAGCTAAGCCTAATTCAATAGAGAATCCGATTGATCGATACCATGAGGAAGGTGATGATGCCGAAGAAGGAGAGATCGCCGGAGGAGAAGGAGACGGAAACGTTGACGAATCGAGCAAATCCGGTGTTCCTGAATCGCATCCTCTGGAACATTCATGGACTTTCTGGTTCGATAATCCTGCTGTGAAATCGAAACAAACCTCTTGGGGAAGTTCCTTGCGACCCGTGTTTACGTTTTCAACTGTTGAGGAATTTTGGAGTTTGTACAACAACATGAAGCATCCGAGCAAGTTAGCTCACGGAGCTGACTTCTACTGTTTCAAACACATCATTGAACCTAAGTGGGAGGATCCTATTTGTGCTAATGGAGGAAAATGGACTATGACTTTCCCTAAGGAGAAGTCTGATAAGAGCTGGCTCTACACTTTGCTTGCATTGATTGGAGAGCAGTTTGATCATGGAGATGAAATATGTGGAGCAGTTGTCAACATTAGAGGAAAGCAAGAAAGGATATCTATTTGGACTAAAAATGCTTCAAACGAAGCTGCTCAGGTGAGCATTGGAAAACAATGGAAGGAGTTTCTCGATTACAACAACAGCATAGGTTTCATCATCCATGAGGATGCGAAGAAGCTCGACAGGAATGCAAAGAACGCTTACACCGCTTGAAACCTCTCAAATCTTTGCATTGTTTCAATTACAGTTTTGTATGTGAGAGATCTCTATTTATCTAAACATGACTTGACAGTCTGTCTTTGCTAGTGTTGATTGTTCACGAAGCTCTAACATTTCATTTAGTAATATATTAGTATGGTTCTTCATAATATTTACGTTGGTGCCCTTGTATAAAACCACCGGAGTGA
CDS Sequence
Protein Sequence