Gene Details:
- Gene ID: AT4G18100
- Gene Symbol: eL32z
- Gene Name: Ribosomal Protein eL32z
- Description: Ribosomal protein L32e;(source:Araport11)
- TAIR Accession: locus:2117696
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
Gene Ontology:
- GO:0003729 — enables — mRNA binding
- GO:0022625 — part of — cytosolic large ribosomal subunit
- GO:0005737 — located in — cytoplasm
- GO:0022625 — located in — cytosolic large ribosomal subunit
- GO:0005730 — located in — nucleolus
- GO:0006412 — involved in — translation
- GO:0005829 — located in — cytosol
- GO:0022626 — located in — cytosolic ribosome
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- Localization of organelle proteins by isotope tagging (LOPIT). DOI: 10.1074/mcp.T400009-MCP200 ; PMID: 15295017
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. DOI: 10.1091/mbc.e04-09-0791 ; PMID: 15496452
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
Sequence:
cDNA Sequence
- >AT4G18100.1 GTTGAAGGAAAAAACGAAAAGGCCGTGAAAGAAATCTTATTGGGCCACAACGTGAGCCCATTTAGTAATGTAATATCAGAAACCCTAGTGTACGCTTATAAAAGACATTTTAGGTTTGTTCAGCTGTTTTACGGAGTCGCTTTTGAGATATCGATCTTACGAAGAAGCAAATATGGCGGTCCCATTGCTTACCAAGAAGGTTGTGAAGAAGAGGTCTGCTAAGTTCATCAGACCCCAGAGTGACCGTAGAATCACCGTCAAGGAAAGCTGGAGGAGGCCAAAGGGTATTGATTCAAGGGTGAGAAGAAAGTTCAAAGGTGTGACTTTGATGCCCAATGTTGGTTACGGATCTGACAAGAAGACTCGTCACTATCTTCCCAATGGATTCAAGAAATTCGTTGTTCACAACACAAGTGAGCTCGAGTTGTTGATGATGCACAACAGGACTTACTGTGCTGAGATTGCTCACAACGTCTCCACTAAGAAGAGAAAGGCAATTGTTGAGAGAGCTTCTCAGCTAGACGTTGTTGTTACCAACAGGCTTGCTAGGCTCCGTAGCCAAGAAGACGAGTGAAGAAGAATCTTGCCTACTACTTAGTTGTTTCTTCTGTTTTGTTGCATTTCCTTTTTGTTATAAGACGATTTTTGATTACTGCTGTGTTTGTGTTTGGAGTGAACAAACATGAGTTTTGGTTTTAGTATGAAACAGATCAAGTTAAGACCTTTTGTTAAAGCTATTTCGGATTCATTACTTGTCAAAGGTTGAGCCTATTTCATCTAGAATTTAATAATTTGTCAGAGGATCTCAATTTAACTTGGTG
CDS Sequence
Protein Sequence