Gene Details:
- Gene ID: AT4G18470
- Gene Symbol: NSE5, SNI1
- Gene Name: NON-SMC ELEMENT 5, SUPPRESSOR OF NPR1-1, INDUCIBLE 1
- Description: negative regulator of systemic acquired resistance (SNI1);(source:Araport11)
- TAIR Accession: locus:2124534
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0045892 — involved in — negative regulation of DNA-templated transcription
- GO:0005634 — located in — nucleus
- GO:0010113 — involved in — negative regulation of systemic acquired resistance
- GO:0005515 — enables — protein binding
- GO:0006338 — involved in — chromatin remodeling
- GO:0031348 — involved in — negative regulation of defense response
- GO:0006974 — involved in — DNA damage response
- GO:0005634 — is active in — nucleus
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0009627 — acts upstream of or within — systemic acquired resistance
- GO:0030915 — part of — Smc5-Smc6 complex
- GO:0002215 — involved in — defense response to nematode
- GO:0045892 — acts upstream of or within — negative regulation of DNA-templated transcription
- GO:0010113 — acts upstream of or within — negative regulation of systemic acquired resistance
- GO:0016444 — acts upstream of or within — somatic cell DNA recombination
Function-related keywords:
Literature:
- Identification and cloning of a negative regulator of systemic acquired resistance, SNI1, through a screen for suppressors of npr1-1. DOI: 10.1016/s0092-8674(00)81962-5 ; PMID: 10458608
- Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. DOI: 10.1073/pnas.96.11.6523 ; PMID: 10339621
- Regulation of systemic acquired resistance by NPR1 and its partners. DOI: 10.1002/9780470515778.ch12 ; PMID: 11387978
- A comprehensive structure-function analysis of Arabidopsis SNI1 defines essential regions and transcriptional repressor activity. DOI: 10.1105/tpc.105.039677 ; PMID: 16766691
- Arabidopsis SNI1 and RAD51D regulate both gene transcription and DNA recombination during the defense response. DOI: 10.1073/pnas.0609357104 ; PMID: 17360504
- Genetic interactions of TGA transcription factors in the regulation of pathogenesis-related genes and disease resistance in Arabidopsis. DOI: 10.1104/pp.106.095299 ; PMID: 17369431
- Cyst nematode parasitism of Arabidopsis thaliana is inhibited by salicylic acid (SA) and elicits uncoupled SA-independent pathogenesis-related gene expression in roots. DOI: 10.1094/MPMI-21-4-0424 ; PMID: 18321188
- The Arabidopsis PR-1 promoter contains multiple integration sites for the coactivator NPR1 and the repressor SNI1. DOI: 10.1104/pp.110.165563 ; PMID: 20935179
- Arabidopsis BRCA2 and RAD51 proteins are specifically involved in defense gene transcription during plant immune responses. DOI: 10.1073/pnas.1005978107 ; PMID: 21149701
- Exchanging the as-1-like element of the PR-1 promoter by the as-1 element of the CaMV 35S promoter abolishes salicylic acid responsiveness and regulation by NPR1 and SNI1. DOI: 10.4161/psb.5.12.14033 ; PMID: 21139438
- DNA repair proteins are directly involved in regulation of gene expression during plant immune response. DOI: 10.1016/j.chom.2011.01.011 ; PMID: 21320694
- Systematic identification of functional plant modules through the integration of complementary data sources. DOI: 10.1104/pp.112.196725 ; PMID: 22589469
- Salicylic acid activates DNA damage responses to potentiate plant immunity. DOI: 10.1016/j.molcel.2013.09.019 ; PMID: 24207055
- Influence of Human p53 on Plant Development. DOI: 10.1371/journal.pone.0162840 ; PMID: 27648563
- Defects in meiotic chromosome segregation lead to unreduced male gametes in Arabidopsis SMC5/6 complex mutants. DOI: 10.1093/plcell/koab178 ; PMID: 34240187
- Natural variation identifies SNI1, the SMC5/6 component, as a modifier of meiotic crossover in Arabidopsis. DOI: 10.1073/pnas.2021970118 ; PMID: 34385313
Sequence:
cDNA Sequence
- >AT4G18470.1 AAGATTTCAATCTCTCCTTCTCGTTTTCTTCTTTGGTGCTGCTGAGAAGAAATTAGTGAAATTGTGAAAGAGAAGATGTCGAAAGAGACGAAGGGTAATAACAATACAAGCAGAGTGATGAGTGGCTATGGCGGTAGCTTGGAAGCTAACACCTTGGCTATGATTGATTCCACCGGAGCTAAAGACAGTCGCGACGCTAACGAAGATCGTTTGCAGTATCTGGAAGCTGTTCGTGCTGCTTCACTTGTACCCGAAAATGGAATTCCTCCAACCAACAAAATGTACCAAGCGATTTTCAGGATATTGAGATTTGGTAAAACATTGGAACTTATCACAGCAAGTTTCCAGCTTTTGACTCAATTACATCAGCGGTTTCCTTGGGTTTATGTATCTGATTCAGCTGATCAGTTGGACATCGTTGACGAGGCTTGGTCACCGTTTAATTTCGGGTCTGATGTTGATTCTGATGAAAAGGATTTATCAGTGAGAAGCTTATTTTTGCAACAGCTGATTCAGAACATGAACAAAAGAGTTAATGAGTCTGAGGAATCAGATTTAAAGATCCTTGGAAATATGTTTCTGTTCAAGTATCTTGCTCATGTTCTTAAGCTAGATTTCACACCCCGAAATCAAGTGTATGAAGAAACTATGAACTGGAGTCTCTTAAAGGAATCTTTTCTGAATCTACTTCTGGCTTCAAGAAAAGTGAATTTCAAACTTCTAATGAAAGATTATCTATCAACAATGTGTGCATCCATTGATGCTGATGAAAAGTCTATCAGTTTGGTAGAATTGCACAAGGACATGCTTACTGCTATGAAAGAACTTCTAGTAATGATCATGGAGCTTGATACATCAAAGAAGAAAGCTGACTTAGAAGGGATTACCTCTAGAGGAGATGGCGTAAGGACCCCTGCAATGGAGATCATTCTCGACGAGCTGACTTATGATGGATACTTGCTGTCAAAATTTCTTCAGGTTTTCGATGATCCTAAATGGAAGCTAGAGATTGTTCTCCAATACCTTACTAAATACATTCCTAAGCCTGTTGTACGTACCCGAAGAACAACTGTTCCTCAAGCAGAGGATTCGAAAACACTAAATGGGATCTTGAAGACGTTTTCAAATGGCACAAATCCAAAGAACATCACTAAAAAGATAGGACCTGACATTGTTCAGATCCTCATCGGCCATGCCTTTCTGGCTCGGCTTACATTCTCTGACCCTCACGAAGGAGACTCTATTTCAGAGATATGCAGTAGTATCATCTCTGCATTTACTAGTCTAAAGCGAGTAGATCAGAAAATCGAGATTCTACCGTTTGGGAAAGAAGTGTTGTTTACTGCAGGAATGGTACTCAAGGCAAAAGCTTAAAGCATCTAGGAATCAAGATTTTAACAAATCTAGAGACTTCAATTGGATTAGAAGCAAAGAAGTTACAATGTAATGTAGGAATTAAGAGTTACAGATCAATGAATTATGAATTTATATATTCTATAGTTTTGCCAATACAAAATGAGTGATC
CDS Sequence
Protein Sequence