Gene Details:
- Gene ID: AT4G18480
- Gene Symbol: CH-42, CH42, CHL11, CHLI-1, CHLI1, LOST1
- Gene Name: CHLORINA 42, CHLORINA 42, low temperature with open-stomata 1
- Description: P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
- TAIR Accession: locus:2005500
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0009570 — located in — chloroplast stroma
- GO:0009507 — located in — chloroplast
- GO:0015995 — acts upstream of or within — chlorophyll biosynthetic process
- GO:0016887 — enables — ATP hydrolysis activity
- GO:0016851 — enables — magnesium chelatase activity
Function-related keywords:
Literature:
- Identification of a vinyl reductase gene for chlorophyll synthesis in Arabidopsis thaliana and implications for the evolution of Prochlorococcus species. DOI: 10.1105/tpc.104.027276 ; PMID: 15632054
- An Arabidopsis mutant that is resistant to the protoporphyrinogen oxidase inhibitor acifluorfen shows regulatory changes in tetrapyrrole biosynthesis. DOI: 10.1007/s00438-005-1129-6 ; PMID: 15815918
- CAUT lines: a novel resource for studies of cell autonomy in Arabidopsis. DOI: 10.1111/j.1365-313X.2007.03321.x ; PMID: 18269574
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Functional analysis of Arabidopsis thaliana isoforms of the Mg-chelatase CHLI subunit. DOI: 10.1039/b802604c ; PMID: 18846282
- Identification of nuclear genes encoding chloroplast-localized proteins required for embryo development in Arabidopsis. DOI: 10.1104/pp.110.168120 ; PMID: 21139083
- Roles of the different components of magnesium chelatase in abscisic acid signal transduction. DOI: 10.1007/s11103-012-9965-3 ; PMID: 23011401
- A survey of dominant mutations in Arabidopsis thaliana. DOI: 10.1016/j.tplants.2012.08.006 ; PMID: 22995285
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- Novel constructs for efficient cloning of sRNA-encoding DNA and uniform silencing of plant genes employing artificial trans-acting small interfering RNA. DOI: 10.1007/s00299-016-2024-9 ; PMID: 27417696
- Transcriptional Regulation of Tetrapyrrole Biosynthesis in Arabidopsis thaliana. DOI: 10.3389/fpls.2016.01811 ; PMID: 27990150
- Shade represses photosynthetic genes by disrupting the DNA binding of GOLDEN2-LIKE1. DOI: 10.1093/plphys/kiad029 ; PMID: 36702576
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
- Functional analysis of Arabidopsis thaliana isoforms of the Mg-chelatase CHLI subunit. DOI: 10.1039/b802604c ; PMID: 18846282
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequence:
cDNA Sequence
- >AT4G18480.1 TATCTCCTTATCCTGACCACAGAAACAAACATAAGCCAATGGAAACAAAAAAATTCTAAGGTGAAAAAAGCCAATCAGAAGCTGAGTAAACTCTAAGCTCACACAAAAATGGCGTCTCTTCTTGGAACATCTTCTTCTGCAATCTGGGCTTCTCCTTCACTCTCTTCTCCTTCCTCAAAACCTTCCTCCTCCCCCATTTGCTTCAGGCCAGGAAAATTGTTTGGAAGCAAGTTAAATGCAGGAATCCAAATAAGGCCAAAGAAGAACAGGTCTCGTTACCATGTTTCGGTTATGAATGTAGCCACTGAAATCAACTCTACTGAACAAGTAGTAGGGAAGTTTGATTCAAAGAAGAGTGCGAGACCGGTTTATCCATTTGCAGCTATAGTAGGGCAAGATGAGATGAAGTTATGTCTTTTGTTGAATGTTATTGATCCAAAGATTGGTGGTGTTATGATTATGGGAGATAGAGGAACTGGAAAATCTACAACTGTTAGATCATTAGTTGATCTGTTACCTGAGATTAATGTAGTTGCAGGTGACCCGTATAACTCGGATCCGATAGATCCTGAGTTTATGGGTGTTGAAGTAAGAGAGAGAGTTGAGAAAGGAGAGCAAGTTCCTGTTATTGCGACTAAGATTAATATGGTTGATCTTCCTTTGGGTGCAACAGAAGATAGAGTTTGTGGAACCATCGATATCGAAAAGGCTTTGACAGAAGGTGTAAAAGCCTTTGAGCCTGGTTTGTTGGCTAAAGCTAATAGAGGGATTCTTTATGTTGATGAAGTTAATCTCTTGGATGATCATTTGGTTGATGTTCTTTTGGATTCAGCTGCTTCTGGTTGGAATACGGTTGAGAGAGAAGGGATTTCGATTTCTCACCCGGCGAGGTTTATCTTGATCGGTTCAGGAAATCCGGAAGAAGGAGAGCTTAGGCCACAGCTTCTTGATCGGTTTGGTATGCATGCACAAGTAGGGACGGTTAGAGATGCTGATTTACGGGTCAAGATTGTTGAAGAGAGAGCTCGTTTCGATAGTAACCCAAAGGATTTCCGTGACACTTACAAAACCGAGCAGGACAAGCTTCAAGACCAGATTTCAACTGCTAGGGCAAACCTTTCCTCGGTTCAGATTGATAGGGAATTGAAGGTGAAGATCTCTAGAGTTTGTTCAGAGCTCAATGTTGATGGGTTGAGAGGAGACATAGTGACTAACAGAGCAGCAAAAGCACTTGCAGCTCTCAAAGGAAAAGATCGAGTAACTCCAGATGATGTTGCAACCGTTATCCCTAACTGCTTAAGGCACCGTCTGAGGAAAGATCCACTGGAATCTATTGATTCAGGAGTTCTAGTTTCCGAGAAGTTCGCCGAGATTTTCAGCTGAATAGGAGATTCGATTCTGTGATCATTTTTCTTTAACTTTTTCTACTCTGTAAACGGTGAGAAGAACCAAAACTATAAACAGGCAAATCTGATTGAATATAGAGTCTATGCTTTATTCATTAAGTTGAGTTGTTCAAACTTCAAATCATAGACTCAATAGAACTCTGTTTATATTTGTGTAACTACATACAAACATTCCTGCATTGATTATGGCTATAAAGCTATC
CDS Sequence
Protein Sequence