Gene Details:
- Gene ID: AT4G20990
- Gene Symbol: ACA4, ATACA4
- Gene Name: alpha carbonic anhydrase 4, A. THALIANA ALPHA CARBONIC ANHYDRASE 4
- Description: alpha carbonic anhydrase 4;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
Function-related keywords:
Literature:
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- A comparison of the Thlaspi caerulescens and Thlaspi arvense shoot transcriptomes. DOI: 10.1111/j.1469-8137.2006.01662.x ; PMID: 16608451
- Characterization and expression analysis of genes encoding alpha and beta carbonic anhydrases in Arabidopsis. DOI: 10.1111/j.1365-3040.2007.01651.x ; PMID: 17407539
- Genome-wide identification of osmotic stress response gene in Arabidopsis thaliana. DOI: 10.1016/j.ygeno.2008.08.011 ; PMID: 18804526
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Identification of novel proteins involved in plant cell-wall synthesis based on protein-protein interaction data. DOI: 10.1021/pr100249c ; PMID: 20687615
- Three MYB transcription factors control pollen tube differentiation required for sperm release. DOI: 10.1016/j.cub.2013.05.021 ; PMID: 23791732
- Participation of Two Carbonic Anhydrases of the Alpha Family in Photosynthetic Reactions in Arabidopsis thaliana. DOI: 10.1134/S0006297916100151 ; PMID: 27908242
- The role of carbonic anhydrase α-CA4 in the adaptive reactions of photosynthetic apparatus: the study with α-CA4 knockout plants. DOI: 10.1007/s00709-019-01456-1 ; PMID: 31784823
- The Role of Carbonic Anhydrase αCA4 in Photosynthetic Reactions in Arabidopsis thaliana Studied, Using the Cas9 and T-DNA Induced Mutations in Its Gene. DOI: 10.3390/plants11233303 ; PMID: 36501340
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
Sequence:
cDNA Sequence
- >AT4G20990.1 ATGGATACCAACGCAAAAACAATTTTCTTCATGGCTATGTGTTTCATCTATCTATCTTTCCCTAATATTTCACACGCTCATTCTGAAGTCGACGACGAAACTCCATTTACTTACGAACAAAAAACGGAAAAGGGACCAGAGGGATGGGGCAAAATAAATCCGCACTGGAAAGTTTGTAACACCGGAAGATATCAATCCCCGATCGATCTTACTAACGAAAGAGTCAGTCTTATTCATGATCAAGCATGGACAAGACAATATAAACCAGCTCCGGCTGTAATTACAAACAGAGGCCATGACATTATGGTATCATGGAAAGGAGATGCTGGGAAGATGACAATACGGAAAACGGATTTTAATTTGGTGCAATGCCATTGGCATTCACCTTCTGAGCATACCGTTAACGGAACTAGGTACGACCTAGAGCTTCACATGGTTCACACGAGTGCACGAGGCAGAACTGCGGTTATCGGAGTTCTTTACAAATTAGGCGAACCTAATGAATTCCTCACCAAGCTACTAAATGGAATAAAAGCAGTGGGAAATAAAGAGATAAATCTAGGGATGATTGATCCACGAGAGATTAGGTTTCAAACAAGAAAATTCTATAGATACATTGGCTCTCTCACTGTTCCTCCTTGCACTGAAGGCGTCATTTGGACTGTCGTCAAAAGGGTGAACACAATATCAATGGAGCAAATTACAGCTCTTAGGCAAGCCGTTGACGATGGATTTGAGACAAATTCAAGACCGGTTCAAGACTCAAAGGGAAGATCAGTTTGGTTCTATGATCCAAATGTTTGATATATTTACTTCTATTATTTTG
CDS Sequence
Protein Sequence