Gene Details:
- Gene ID: AT4G21050
- Gene Symbol: AtDOF4.4, DOF4.4
- Gene Name: DNA-binding with One Finger 4.4
- Description: Dof-type zinc finger domain-containing protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009001 — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
Function-related keywords:
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The Dof family of plant transcription factors. DOI: 10.1016/s1360-1385(02)02362-2 ; PMID: 12475498
- Genome-wide comparative phylogenetic analysis of the rice and Arabidopsis Dof gene families. DOI: 10.1186/1471-2148-3-17 ; PMID: 12877745
- Generation of Arabidopsis protein chips for antibody and serum screening. DOI: 10.1023/a:1025424814739 ; PMID: 14558660
- Trehalose mediated growth inhibition of Arabidopsis seedlings is due to trehalose-6-phosphate accumulation. DOI: 10.1104/pp.104.039503 ; PMID: 15181209
- Divergence of the Dof gene families in poplar, Arabidopsis, and rice suggests multiple modes of gene evolution after duplication. DOI: 10.1104/pp.106.083642 ; PMID: 16980566
- The genetic framework of shoot regeneration in Arabidopsis comprises master regulators and conditional fine-tuning factors. DOI: 10.1038/s42003-020-01274-9 ; PMID: 33009513
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Sequence:
cDNA Sequence
- >AT4G21050.1 ATGGATAACTTGAATGTTTTCGCTAATGAAGACAATCAAGTGAATGGTTTGAAGCGTCCACCCCCGTCACGAGTGTGTCCAAGGTGTGATTCTGATAACACTAAGTTTTGCTTTTACAACAACTACAGTGAATCTCAACCGCGCTACTTTTGCAAAAACTGTCGTAGATATTGGACTCATGGTGGAGCTTTAAGAAACATACCAGTTGGTGGAAGTTGTCGTAAACCAAAGCGTCTGAAGGTAGATCAATCTTCGATTTCTGAGATGGTTTCTGTTGAGAACCAACCAATTAATCATCAATCTTTCAGACAAACTCAAGAAAACAATGAGTTTGTTCGATCTTTTGACGCTTCTTCTTCTGCTACTGTTACTGCCGTTCCGAACCATTTTGGTTATCTAAGTGAACTTCATGGTGTAACAAATTTGCTTCCAATTCAAAGTTTTCGAACAATGGACTGCTTAGATTTCGGTGATGAATCTTTTCAACAAGGTTATTACGATGTTGGATCCAATGATTTGATTGATAACCCTTTGATAAACCAATCCATCGGTGGGTATGTTGATAATCTTACAAGTTATTGCATAAATCAAGTGGAACCAAAGCTTCAACCACGCTATGAACATGAATCATAA
CDS Sequence
Protein Sequence