Gene Details:
- Gene ID: AT4G21280
- Gene Symbol: PSBQ, PSBQ-1, PSBQA
- Gene Name: PHOTOSYSTEM II SUBUNIT Q, PHOTOSYSTEM II SUBUNIT Q-1, photosystem II subunit QA
- Description: photosystem II subunit QA;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
- PO:0009049 — inflorescence — inflorescencia (Spanish, exact), 花序 (Japanese, exact), Triticeae spike (narrow)
- PO:0005679 — plant epidermis — dermal tissue (exact), epidermal layer (exact), epidermides (exact, plural), epidermis (Spanish, exact), epidermises (exact, plural), portion of epidermal tissue (exact), 表皮 (Japanese, exact), multiseriate epidermis (related)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
- vascular leaf , stem , inflorescence , plant epidermis , root , pollen , guard cell
Literature:
- Proteome map of the chloroplast lumen of Arabidopsis thaliana. DOI: 10.1074/jbc.M108575200 ; PMID: 11719511
- Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis determined by experimentation and genome-wide prediction. DOI: 10.1105/tpc.010304 ; PMID: 11826309
- The FHY3 and FAR1 genes encode transposase-related proteins involved in regulation of gene expression by the phytochrome A-signaling pathway. DOI: 10.1046/j.1365-313x.2003.01741.x ; PMID: 12753585
- Monitoring expression profiles of Arabidopsis gene expression during rehydration process after dehydration using ca 7000 full-length cDNA microarray. DOI: 10.1046/j.1365-313x.2003.01774.x ; PMID: 12795706
- A new approach for plant proteomics: characterization of chloroplast proteins of Arabidopsis thaliana by top-down mass spectrometry. DOI: 10.1074/mcp.M300069-MCP200 ; PMID: 14506204
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- Transcriptional profiling by cDNA-AFLP and microarray analysis reveals novel insights into the early response to ethylene in Arabidopsis. DOI: 10.1111/j.1365-313X.2004.02156.x ; PMID: 15272873
- New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. DOI: 10.1074/jbc.M406763200 ; PMID: 15322131
- Functional dissection of two Arabidopsis PsbO proteins: PsbO1 and PsbO2. DOI: 10.1111/j.1742-4658.2005.04636.x ; PMID: 15853801
- The MAP kinase substrate MKS1 is a regulator of plant defense responses. DOI: 10.1038/sj.emboj.7600737 ; PMID: 15990873
- Identification of plant glutaredoxin targets. DOI: 10.1089/ars.2005.7.919 ; PMID: 15998247
- Cis-regulatory element based targeted gene finding: genome-wide identification of and abiotic stress-responsive genes in Arabidopsis thaliana. DOI: 10.1093/bioinformatics/bti490 ; PMID: 15890746
- Distinct functions for the two PsbP-like proteins PPL1 and PPL2 in the chloroplast thylakoid lumen of Arabidopsis. DOI: 10.1104/pp.107.105866 ; PMID: 17827269
- Proteomic analysis of S-nitrosylated proteins in Arabidopsis thaliana undergoing hypersensitive response. DOI: 10.1002/pmic.200700536 ; PMID: 18297659
- An extensive (co-)expression analysis tool for the cytochrome P450 superfamily in Arabidopsis thaliana. DOI: 10.1186/1471-2229-8-47 ; PMID: 18433503
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- The effects of simultaneous RNAi suppression of PsbO and PsbP protein expression in photosystem II of Arabidopsis. DOI: 10.1007/s11120-008-9352-8 ; PMID: 18791808
- The PsbP protein, but not the PsbQ protein, is required for normal thylakoid architecture in Arabidopsis thaliana. DOI: 10.1016/j.febslet.2009.05.048 ; PMID: 19500580
- Arabidopsis plants lacking PsbQ and PsbR subunits of the oxygen-evolving complex show altered PSII super-complex organization and short-term adaptive mechanisms. DOI: 10.1111/tpj.12230 ; PMID: 23647309
- Different response of photosystem II to short and long-term drought stress in Arabidopsis thaliana. DOI: 10.1111/ppl.12438 ; PMID: 26918860
- Identification and Roles of Photosystem II Assembly, Stability, and Repair Factors in Arabidopsis. DOI: 10.3389/fpls.2016.00168 ; PMID: 26909098
- Analysis of the herbicidal mechanism of 4-hydroxy-3-methoxy cinnamic acid ethyl ester using iTRAQ and real-time PCR. DOI: 10.1016/j.jprot.2017.02.014 ; PMID: 28242453
- Photosystem II Extrinsic Proteins and Their Putative Role in Abiotic Stress Tolerance in Higher Plants. DOI: 10.3390/plants7040100 ; PMID: 30441780
- The Low Molecular Mass Photosystem II Protein PsbTn Is Important for Light Acclimation. DOI: 10.1104/pp.18.01251 ; PMID: 30538167
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- The Absence of the AtSYT1 Function Elevates the Adverse Effect of Salt Stress on Photosynthesis in Arabidopsis. DOI: 10.3390/ijms23031751 ; PMID: 35163669
- Proteome map of the chloroplast lumen of Arabidopsis thaliana. DOI: 10.1074/jbc.M108575200 ; PMID: 11719511
- Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis determined by experimentation and genome-wide prediction. DOI: 10.1105/tpc.010304 ; PMID: 11826309
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. DOI: 10.1074/jbc.M406763200 ; PMID: 15322131
- PsbR, a missing link in the assembly of the oxygen-evolving complex of plant photosystem II. DOI: 10.1074/jbc.M510600200 ; PMID: 16282331
- Proteomic analysis of S-nitrosylated proteins in Arabidopsis thaliana undergoing hypersensitive response. DOI: 10.1002/pmic.200700536 ; PMID: 18297659
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
Sequence:
cDNA Sequence
- >AT4G21280.2 AATAATCATCGGCTTCAATTTTCGTCTTGAGAAAGAAAAACAAAATGGCTTCGATGGGTGGATTACACGGTGCATCTCCGGCGGTTCTTGAAGGAAGCTTAAAGATCAATGGCTCCAGCCGTCTGAATGGCTCTGGAAGAGTGGCGGTGGCTCAAAGGTCTAGACTTGTCGTCAGAGCTCAGCAGAGTGAGGAGACTTCTCGCCGGTCCGTGATTGGGCTTGTTGCTGCTGGTTTAGCTGGTGGCTCGTTTGTTCAGGCTGTCCTCGCCGATGCTATTTCGATCAAAGTTGGCCCTCCTCCAGCTCCTTCCGGTGGCCTTCCAGCTGGGACAGATAACTCAGACCAAGCAAGAGACTTTGCATTGGCATTGAAAGACAGGTTTTACTTACAGCCATTGCCACCAACAGAAGCTGCAGCTAGAGCCAAAGAATCTGCAAAGGATATCATAAATGTGAAGCCATTGATCGACAGGAAAGCTTGGCCATATGTTCAAAACGATCTTCGTTCCAAGGCTTCTTATCTTCGTTATGATCTTAACACAATCATTTCCTCCAAACCCAAGGATGAGAAGAAGTCACTCAAGGATCTCACCACCAAGCTCTTCGATACCATCGACAATCTGGATTATGCGGCGAAGAAGAAGAGTCCTTCGCAGGCTGAGAAGTACTATGCTGAGACAGTCTCTGCTTTGAACGAAGTTCTTGCCAAGCTTGGTTAAGCATTTTAATTTCTGCATTTTTCTTGTAAATTATTATTCTTGGTTTTTGTTCTTGAGTACTTTAGACTCAAATTCGTGAATCTGAATTTATGTTTCACGTTTTCACCAAGTAATGGCAATTTCTTGAGTATGCGTTAGCTTTGTTTGCATGGTGATTTAGCAAACAACAACATAAAGTCTATTCGT
- >AT4G21280.1 AATAATCATCGGCTTCAATTTTCGTCTTGAGAAAGAAAAACAAAATGGCTTCGATGGGTGGATTACACGGTGCATCTCCGGCGGTTCTTGAAGGAAGCTTAAAGATCAATGGCTCCAGCCGTCTGAATGGCTCTGGAAGAGTGGCGGTGGCTCAAAGGTCTAGACTTGTCGTCAGAGCTCAGCAGAGTGAGGAGACTTCTCGCCGGTCCGTGATTGGGCTTGTTGCTGCTGGTTTAGCTGGTGGCTCGTTTGTTCAGGCTGTCCTCGCCGATGCTATTTCGATCAAAGTTGGCCCTCCTCCAGCTCCTTCCGGTGGCCTTCCAGCTGGGACAGATAACTCAGACCAAGCAAGAGACTTTGCATTGGCATTGAAAGACAGGTTTTACTTACAGCCATTGCCACCAACAGAAGCTGCAGCTAGAGCCAAAGAATCTGCAAAGGATATCATAAATGTGAAGCCATTGATCGACAGGAAAGCTTGGCCATATGTTCAAAACGATCTTCGTTCCAAGGCTTCTTATCTTCGTTATGATCTTAACACAATCATTTCCTCCAAACCCAAGGATGAGAAGAAGTCACTCAAGGATCTCACCACCAAGCTCTTCGATACCATCGACAATCTGGATTATGCGGCGAAGAAGAAGAGTCCTTCGCAGGCTGAGAAGTACTATGCTGAGACAGTCTCTGCTTTGAACGAAGTTCTTGCCAAGCTTGGTTAAGCATTTTAATTTCTGCATTTTTCTTGTAAATTATTATTCTTGGTTTTTGTTCTTGAGTACTTTAGACTCAAATTCGTGAATCTGAATTTATGTTTCACGTTTTCACCAAGTAATGGCAATTTCTTGAGTATGCGTTAGCTTTGTTTGCATGGTGATTTAGCAAACAACAACATAAAGTCTATTCGT
CDS Sequence
Protein Sequence