Gene Details:
- Gene ID: AT4G21960
- Gene Symbol: PRXR1
- Gene Name:
- Description: Peroxidase superfamily protein;(source:Araport11)
- TAIR Accession: locus:2141637
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0004601 — enables — peroxidase activity
- GO:0006979 — involved in — response to oxidative stress
- GO:0006950 — involved in — response to stress
- GO:0020037 — enables — heme binding
- GO:0009505 — located in — plant-type cell wall
- GO:0009505 — is active in — plant-type cell wall
Function-related keywords:
Literature:
- Structural diversity and transcription of class III peroxidases from Arabidopsis thaliana. DOI: 10.1046/j.1432-1033.2002.03311.x ; PMID: 12473102
- Genomic analysis of the unfolded protein response in Arabidopsis shows its connection to important cellular processes. DOI: 10.1105/tpc.007609 ; PMID: 12566592
- Effects of leaf ascorbate content on defense and photosynthesis gene expression in Arabidopsis thaliana. DOI: 10.1089/152308603321223513 ; PMID: 12626114
- Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome. DOI: 10.1104/pp.103.028241 ; PMID: 14500793
- The Arabidopsis root transcriptome by serial analysis of gene expression. Gene identification using the genome sequence. DOI: 10.1104/pp.103.030536 ; PMID: 14730065
- Trehalose mediated growth inhibition of Arabidopsis seedlings is due to trehalose-6-phosphate accumulation. DOI: 10.1104/pp.104.039503 ; PMID: 15181209
- Expression analysis of the Arabidopsis peroxidase multigenic family. DOI: 10.1016/j.phytochem.2004.04.017 ; PMID: 15231406
- Maximizing the efficacy of SAGE analysis identifies novel transcripts in Arabidopsis. DOI: 10.1104/pp.104.043406 ; PMID: 15489285
- Global transcript profiling of primary stems from Arabidopsis thaliana identifies candidate genes for missing links in lignin biosynthesis and transcriptional regulators of fiber differentiation. DOI: 10.1111/j.1365-313X.2005.02403.x ; PMID: 15918878
- Expressed sequence tags from the Yukon ecotype of Thellungiella reveal that gene expression in response to cold, drought and salinity shows little overlap. DOI: 10.1007/s11103-005-6163-6 ; PMID: 16021339
- Coffee and tomato share common gene repertoires as revealed by deep sequencing of seed and cherry transcripts. DOI: 10.1007/s00122-005-0112-2 ; PMID: 16273343
- Transcriptional profiling implicates novel interactions between abiotic stress and hormonal responses in Thellungiella, a close relative of Arabidopsis. DOI: 10.1104/pp.105.070508 ; PMID: 16500996
- Exploiting the wild crucifer Thlaspi arvense to identify conserved and novel genes expressed during a plant's response to cold stress. DOI: 10.1007/s11103-006-9080-4 ; PMID: 16972165
- Comparative gene mapping in Arabidopsis lyrata chromosomes 6 and 7 and A. thaliana chromosome IV: evolutionary history, rearrangements and local recombination rates. DOI: 10.1017/S0016672306008287 ; PMID: 17014743
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- An inversion identified in acl1-1 mutant functions as an enhancer of the acl1-1 phenotype. DOI: 10.1266/ggs.83.293 ; PMID: 18931455
- Mechanical load induces upregulation of transcripts for a set of genes implicated in secondary wall formation in the supporting tissue of Arabidopsis thaliana. DOI: 10.1007/s10265-009-0251-7 ; PMID: 19582540
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Laccases and Peroxidases Co-Localize in Lignified Secondary Cell Walls throughout Stem Development. DOI: 10.1104/pp.20.00473 ; PMID: 32699027
Sequence:
cDNA Sequence
- >AT4G21960.1 ACGCTTTTCAATTTTCATTGAATATAGATTCTTAATCACGACTGAACGGAACATACAATTATTGTAGTCTTATAATAATATTGTTGGTTTCTCAAAGTGAAAATGAATAAAGCTTAATGATATATGATCTGTCACGTACTTAAACATATAGAAACAGTAGCAAATTCACCAACTTGCCTTTAATTTACTATAACCTTCAAATTAAGCTTCTTTTATTTTATGAAAAATAAATAAAGAAAACTCCATTTCCCTTTATTTAAGGAGGCTGCATTGCTTGCTCACTGACTCAACTCAAGAGTGGTGTAGTGAGAGAAGAAAGATAGAGAAAAAAAATGGGAGGCAAAGGTGTGATGATGGTGGCGATACTTTGCCTTTGGGCACTCTCTGCAACATCTGAAGCAGTAACAGAGGCTGAGCCAGGTTTGATGATGAACTTCTACAAGGACACGTGTCCTCAGGCCGAAGACATCGTCCGTGAACAAGTCAAACTCCTCTACAAACGCCACAAGAACACCGCTTTCTCTTGGCTCCGTAACATCTTCCATGACTGCGCCGTTGAGTCATGTGATGCGTCGCTTTTGCTGGATTCGACAAGAAGAGAGCTAGGAGAGAAAGAACACGACAGGAGCTTCGGACTTAGAAACTTTAGGTACATCGAGGAGATCAAGGAAGCTCTCGAGAGGGAGTGTCCTGGTGTTGTCTCATGTTCTGACATTCTCGTCTTGTCCGCAAGAGAAGGCATCGAAGCAGTAGGAGGACCTTATATTCCTTTGAAGACAGGAAGGAGAGATGGACTTAAAAGCAGGACGGATATGCTCGAGTCATATCTTCCCGACCACAACGAGAGTATCTCCGTCGTTCTTGAAAAGTTCAAATCCATCGGTATCGACACTCCCGGCCTCGTCGCCCTCCTAGGGTCACACAGCGTGGGAAGAACTCACTGTGTCAAGCTGGTCCATCGTTTGTACCCTGAGGTGGACCCGTCCTTAAACCCGGACCACGTCCCTCACATGCTACACAAGTGTCCTGACTCGATCCCTGACCCAAAGGCGGTCCAGTACGTGCGTAACGACCGTGGCACCCCCATGGTGCTAGACAACAATTACTACCGTAACATCCTAGACAACAAGGGTTTGCTCCTTGTGGACCATCAGCTCGCACACGACAAACGAACCAGACCAATCGTTAAGAAGATGGCTAAGGACCAGGCCTACTTCTTCAAGGAGTTCACTAGGGCAATCCAGATCTTATCCGAGAACAACCCCTTGACTGGCTCTAAGGGTGAGATCAGGAAGCAATGTAATCTCGCAAACAAGAACCATTGAAGTTGGAAAAAGTGAGAAAGACAGGGGCTCTGGTGTGTTGAGTTCTCTGCTTGGTACGAACCAAGATGAATAAAAAAATCTTTTAAGTTAAATCAAAGAAAGGGTGATGATGAATACATCATGGTAGTGACCACCTCCTTCTTTTGTGTGTTCAGCCTTAATGCTTTAATTATGATGTTAGTGGCTTTGAGTTATTTAATCTAAATGTTGGCTCTTCGTTGATTTTGGGTTTGTGGTGGGGGTGATATAATGATAATGGAAAGGATGTATGATATGATGGATGGTGTTGGGTATCATGTATGACGATGTAATGATAAGTAAACATGTCCGAATCTTTTGATAATTTGTTCAACATGCATGGTATACATAAGTACTGTGTATGGGTGATATCGATCTATTTTACTGATCTCACCAAAGATTTTAAAAATTTGTAGTAAATGACATGAATAATTGAATATGATATGACTCATGAAAAAGATTCCAAAAATAATAATTCAAAATAAG
CDS Sequence
Protein Sequence