Gene Details:
- Gene ID: AT4G22240
- Gene Symbol: FBN1b
- Gene Name: fibrillin 1b
- Description: Plastid-lipid associated protein PAP / fibrillin family protein;(source:Araport11)
- TAIR Accession: locus:2132006
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0009535 — located in — chloroplast thylakoid membrane
- GO:0009534 — located in — chloroplast thylakoid
- GO:0010287 — located in — plastoglobule
- GO:0005829 — located in — cytosol
- GO:0009536 — located in — plastid
- GO:0009507 — located in — chloroplast
- GO:0031977 — located in — thylakoid lumen
- GO:0005739 — part of — mitochondrion
- GO:0009507 — part of — chloroplast
- GO:0010117 — acts upstream of or within — photoprotection
- GO:0009579 — located in — thylakoid
- GO:0005515 — enables — protein binding
- GO:0005739 — located in — mitochondrion
Function-related keywords:
Literature:
- Proteome map of the chloroplast lumen of Arabidopsis thaliana. DOI: 10.1074/jbc.M108575200 ; PMID: 11719511
- Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis determined by experimentation and genome-wide prediction. DOI: 10.1105/tpc.010304 ; PMID: 11826309
- A network of rice genes associated with stress response and seed development. DOI: 10.1073/pnas.0737574100 ; PMID: 12684538
- Microarray and differential display identify genes involved in jasmonate-dependent anther development. DOI: 10.1023/a:1025045217859 ; PMID: 13677466
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- Microarray expression analyses of Arabidopsis guard cells and isolation of a recessive abscisic acid hypersensitive protein phosphatase 2C mutant. DOI: 10.1105/tpc.019000 ; PMID: 14973164
- New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. DOI: 10.1074/jbc.M406763200 ; PMID: 15322131
- Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. DOI: 10.1105/tpc.104.022699 ; PMID: 15319476
- Proteomic analysis and extensive protein identification from dry, germinating Arabidopsis seeds and young seedlings. DOI: 10.5483/bmbrep.2005.38.6.650 ; PMID: 16336779
- Tocopherol cyclase (VTE1) localization and vitamin E accumulation in chloroplast plastoglobule lipoprotein particles. DOI: 10.1074/jbc.M511939200 ; PMID: 16414959
- Protein profiling of plastoglobules in chloroplasts and chromoplasts. A surprising site for differential accumulation of metabolic enzymes. DOI: 10.1104/pp.105.076083 ; PMID: 16461379
- High light response of the thylakoid proteome in arabidopsis wild type and the ascorbate-deficient mutant vtc2-2. A comparative proteomics study. DOI: 10.1104/pp.106.080150 ; PMID: 16648217
- Analyses of synteny between Arabidopsis thaliana and species in the Asteraceae reveal a complex network of small syntenic segments and major chromosomal rearrangements. DOI: 10.1534/genetics.105.049205 ; PMID: 16783026
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Acyl-lipid metabolism. DOI: 10.1199/tab.0161 ; PMID: 23505340
- Phosphorylation of plastoglobular proteins in Arabidopsis thaliana. DOI: 10.1093/jxb/erw091 ; PMID: 26962209
- Lack of FIBRILLIN6 in Arabidopsis thaliana affects light acclimation and sulfate metabolism. DOI: 10.1111/nph.16246 ; PMID: 31596965
- Fibrillin2 in chloroplast plastoglobules participates in photoprotection and jasmonate-induced senescence. DOI: 10.1093/plphys/kiac166 ; PMID: 35404409
- Proteome map of the chloroplast lumen of Arabidopsis thaliana. DOI: 10.1074/jbc.M108575200 ; PMID: 11719511
- Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis determined by experimentation and genome-wide prediction. DOI: 10.1105/tpc.010304 ; PMID: 11826309
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. DOI: 10.1074/jbc.M406763200 ; PMID: 15322131
- Tocopherol cyclase (VTE1) localization and vitamin E accumulation in chloroplast plastoglobule lipoprotein particles. DOI: 10.1074/jbc.M511939200 ; PMID: 16414959
- Protein profiling of plastoglobules in chloroplasts and chromoplasts. A surprising site for differential accumulation of metabolic enzymes. DOI: 10.1104/pp.105.076083 ; PMID: 16461379
- High light response of the thylakoid proteome in arabidopsis wild type and the ascorbate-deficient mutant vtc2-2. A comparative proteomics study. DOI: 10.1104/pp.106.080150 ; PMID: 16648217
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequence:
cDNA Sequence
- >AT4G22240.1 CGTTGATCTTGTCTCTCACGTGGCAGTATCGTAGTCGAATGTACATGATCTATGTGGAATAGTCGATATTATCCCTCTTGGTGTGAGTTTGGTAGTTGATGAAAGCAAAACATTTACGTAACAATGTCTATAAAATCAGTACAGGTCTATTCTTGTTCACTAGCTTCGAAATTTTAGTCGAAGAAACAAAAAAAAATGGCGACGGTACAATTGTCCACCCAATTTAGCTGCCAAACCAGAGTTTCAATCTCACCGAACTCTAAATCTATCTCCAAGCCTCCGTTTCTGGTACCGGTGACCTCAATTATTCACCGCCCGATGATCTCCACCGGAGGAATCGCTGTTTCCCCCCGTAGAGTTTTCAAAGTCCGAGCCACAGATACGGGAGAGATAGGATCAGCTCTATTGGCGGCGGAGGAAGCAATTGAAGACGTGGAAGAGACGGAGCGGCTAAAGAGATCGCTCGTGGATTCGTTGTACGGAACAGATCGAGGTTTAAGCGCATCGAGCGAAACCAGAGCTGAAATCGGAGATCTAATCACACAGCTCGAGTCTAAGAACCCTACTCCAGCTCCGACGGAAGCTCTTTTCCTTCTCAACGGCAAATGGATCCTCGCCTACACATCGTTCGTGAATTTGTTCCCGTTGCTATCACGAGGAATCGTACCGTTAATAAAAGTCGATGAGATCTCTCAAACCATTGATTCAGATAACTTCACCGTCCAGAACTCTGTTCGTTTCGCTGGTCCTTTAGGTACAAACTCGATTAGCACCAACGCTAAATTCGAAATCCGAAGCCCTAAACGCGTCCAGATTAAGTTTGAGCAAGGCGTAATTGGGACGCCTCAGCTAACGGATTCTATTGAGATACCGGAATATGTAGAGGTTCTTGGTCAAAAGATTGATCTTAACCCGATCAGAGGGTTACTTACCTCGGTGCAAGACACAGCCTCGTCTGTGGCTAGAACCATATCAAGCCAACCACCGTTGAAATTCTCTTTGCCGGCGGACAATGCGCAGTCTTGGCTACTCACGACTTATCTAGACAAAGACATTCGGATCTCTAGAGGAGACGGTGGAAGTGTCTTTGTGCTTATCAAAGAAGGAAGCCCTCTCTTGAATCCTTGAACTTGGTCAAAATATATGTCTCTCTCTTGTCGTTGTGTTAAGTGAGACAAATATATAGTGTGGTTGTAGGTTTACTTCTTAATCGTTGTTATTAACTCGATGATAAGGAATATAATGTTTTTAACTACTACAGAACATCTCGTCTATGGCCTATGAAATGTGTCTCAGATTTTCACAAAATTCAAGTGTTTTAGAATTTCATTCTCTTCTGTTTGATTTAGAAAGTAAACTATGTACCGATGCAAGAGTTACATGAGAATTATCCCGGCAACGTCGGGTCTTTCGAT
CDS Sequence
Protein Sequence