Gene Details:
- Gene ID: AT4G22470
- Gene Symbol: AtDHyPRP1, DHyPRP1
- Gene Name: DOUBLE HYBRID PROLINE-RICH PROTEIN 1
- Description: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
Function-related keywords:
- plant embryo , stamen , sepal , hypocotyl
Literature:
- Using genomic resources to guide research directions. The arabinogalactan protein gene family as a test case. DOI: 10.1104/pp.003459 ; PMID: 12177459
- Cell cycle-regulated gene expression in Arabidopsis. DOI: 10.1074/jbc.M207570200 ; PMID: 12169696
- Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. DOI: 10.1104/pp.008532 ; PMID: 12481097
- Changes in gene expression in Arabidopsis shoots during phosphate starvation and the potential for developing smart plants. DOI: 10.1104/pp.103.020941 ; PMID: 12805589
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis. DOI: 10.1111/j.1365-313X.2004.02288.x ; PMID: 15634197
- Transcript profiling in Arabidopsis reveals complex responses to global inhibition of DNA methylation and histone deacetylation. DOI: 10.1074/jbc.M409053200 ; PMID: 15516340
- The eight-cysteine motif, a versatile structure in plant proteins. DOI: 10.1016/j.plaphy.2004.03.009 ; PMID: 15191737
- Detoxification and transcriptome response in Arabidopsis seedlings exposed to the allelochemical benzoxazolin-2(3H)-one. DOI: 10.1074/jbc.M500694200 ; PMID: 15824099
- Gene expression in response to endoplasmic reticulum stress in Arabidopsis thaliana. DOI: 10.1111/j.1742-4658.2005.04770.x ; PMID: 15978049
- Functional genomic analysis of the AUXIN/INDOLE-3-ACETIC ACID gene family members in Arabidopsis thaliana. DOI: 10.1105/tpc.105.036723 ; PMID: 16284307
- Arabidopsis Aux/IAA genes are involved in brassinosteroid-mediated growth responses in a manner dependent on organ type. DOI: 10.1111/j.1365-313X.2005.02582.x ; PMID: 16367964
- Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen Escherichia coli O157:H7. DOI: 10.1111/j.1365-313X.2006.02725.x ; PMID: 16553894
- The Arabidopsis MAP kinase kinase MKK1 participates in defence responses to the bacterial elicitor flagellin. DOI: 10.1111/j.1365-313X.2006.02888.x ; PMID: 17059410
- Suppression by ABA of salicylic acid and lignin accumulation and the expression of multiple genes, in Arabidopsis infected with Pseudomonas syringae pv. tomato. DOI: 10.1007/s10142-006-0041-4 ; PMID: 17149585
- Dual regulation role of GH3.5 in salicylic acid and auxin signaling during Arabidopsis-Pseudomonas syringae interaction. DOI: 10.1104/pp.107.106021 ; PMID: 17704230
- Transcriptional dynamics of two seed compartments with opposing roles in Arabidopsis seed germination. DOI: 10.1104/pp.113.223511 ; PMID: 23858430
Sequence:
cDNA Sequence
- >AT4G22470.1 ATCAAGAATGGCCTCAACTACTATAATCCTTTTCCTCTCATTCAGCATCATTCCATTACTCACCATCGTTAGAGCAGATAACCATTCCGTTTACTGCCCTCCACCACCACCTTGTATTTGTATTTGTAATCCGGGACCACCTCCGCCGCAACCCGATCCCCAACCGCCAACTCCACCAACATTTCAACCAGCACCGCCAGCCAATGACCAACCACCGCCTCCACCACAGAGCACATCACCACCTCCAGTAGCGACCACACCACCAGCACTTCCTCCAAAACCCTTACCGCCACCGTTGTCTCCTCCGCAAACCACACCACCTCCTCCACCAGCTATTACACCACCACCTCCACCAGCTATTACACCTCCACTATCACCTCCTCCACCAGCTATTACACCACCACCTCCACTAGCGACCACACCACCGGCACTTCCTCCAAAACCCTTACCGCCACCGTTGTCTCCTCCACAAACCACGCCACCTCCTCCACCAGCAATCACACCACCACTATCACCTCCTCTGGTTGGAATATGTTCCAAGAATGATACCGAACTAAAGATATGTGCCGGAATTCTAGCAATTAGTGACGGTCTTCTAACCACTGGAAGAGCAGAACCATGTTGTTCCATCATCCGAAATGTGTCTGATCTTGATGCAGTTACTTGTTTTTGTAAATCGGTAGGAGCACCACGTTTTTCCCTCTCTCCCAATTTCGGCATCTTCTTTAAAGTTTGTGGTCGTAGGATTCCACAAGGCTTTAGCTGTCCCGGTCCATCACCAACAATCTCACCACCACCACTTCCTCCACAAACTTTAAAACCGCCTCCGCCACAAACAACACCACCTCCTCCACCAGCTATTACACCACCACTATCACCTCCTCTAGTTGGCATATGCTCCAAGAATGATACCGAACTAAAGATATGTGCCGGAATTCTAGCAATTAGTGACGGCCTTCTAACCACTGGTAGGGCAGAGCCATGTTGTTCCATCGTACGTAATGTGTCTGATCTTGATGCAGTTACTTGTTTTTGTAAGTCGGTAGGAGCAAGACGTTTTTCCCTCTCTCCCAATTTTGGCATCTTCTTTAAGGTTTGTGGTCGCAGGATTCCACAAGGCTTTAGCTGCCCATGATGACCATTTTCTTGCACCACACACATTCTCCTCATTCTCTCTAGTCTTAAATATACAAAGACAGCCTTGTGATTTTTTTTGGGTTCCAACAATGTAATAAATTACCAATGAAATTATATTGTACCTTTGTATCAATTTTCCTTATCTTACAAATAAACCATGTGAGTAACCTTTGCATGCTC
CDS Sequence
Protein Sequence