Gene Details:
- Gene ID: AT4G22680
- Gene Symbol: AtMYB85, MYB85
- Gene Name: myb domain protein 85, myb domain protein 85
- Description: myb domain protein 85;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
Function-related keywords:
Literature:
- Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.1998.00278.x ; PMID: 9839469
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The R2R3-MYB gene family in Arabidopsis thaliana. DOI: 10.1016/s1369-5266(00)00199-0 ; PMID: 11597504
- Plant body weight-induced secondary growth in Arabidopsis and its transcription phenotype revealed by whole-transcriptome profiling. DOI: 10.1104/pp.104.038844 ; PMID: 15194820
- The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. DOI: 10.1007/s11103-005-2910-y ; PMID: 16463103
- SND1, a NAC domain transcription factor, is a key regulator of secondary wall synthesis in fibers of Arabidopsis. DOI: 10.1105/tpc.106.047399 ; PMID: 17114348
- ANAC012, a member of the plant-specific NAC transcription factor family, negatively regulates xylary fiber development in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2007.03109.x ; PMID: 17565617
- The MYB46 transcription factor is a direct target of SND1 and regulates secondary wall biosynthesis in Arabidopsis. DOI: 10.1105/tpc.107.053678 ; PMID: 17890373
- A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. DOI: 10.1105/tpc.108.061325 ; PMID: 18952777
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Improving total saccharification yield of Arabidopsis plants by vessel-specific complementation of caffeoyl shikimate esterase (cse) mutants. DOI: 10.1186/s13068-016-0551-9 ; PMID: 27390589
- Nitric oxide responses in Arabidopsis hypocotyls are mediated by diverse phytohormone pathways. DOI: 10.1093/jxb/ery286 ; PMID: 30085082
- Knockdown of Arabidopsis ROOT UVB SENSITIVE4 Disrupts Anther Dehiscence by Suppressing Secondary Thickening in the Endothecium. DOI: 10.1093/pcp/pcz127 ; PMID: 31268148
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- A PXY-Mediated Transcriptional Network Integrates Signaling Mechanisms to Control Vascular Development in Arabidopsis. DOI: 10.1105/tpc.19.00562 ; PMID: 31806676
- MYB20, MYB42, MYB43, and MYB85 Regulate Phenylalanine and Lignin Biosynthesis during Secondary Cell Wall Formation. DOI: 10.1104/pp.19.01070 ; PMID: 31871072
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Sequence:
cDNA Sequence
- >AT4G22680.1 TTTGGTAAGCTTTTGACATAACTTGCAAGCTGTTGAGATTTTCCATCCTCGATAACTTTATTCTTCCATATCTCTTCCATTTCGCTCTCTATTTCACATCCCCATATAACATAATATACAATCACACATATCATTTCTATATAGTATTTAATGGGGAGACAGCCATGCTGTGACAAGCTAGGGGTGAAGAAAGGGCCGTGGACGGTGGAGGAAGATAAGAAGCTTATAAACTTCATACTAACCAATGGCCATTGTTGCTGGCGTGCTTTGCCGAAGCTGGCCGGTCTCCGTCGCTGTGGAAAGAGCTGCCGCCTCCGGTGGACTAACTATCTCCGGCCTGACTTAAAACGAGGCCTTCTCTCGCATGATGAAGAACAACTTGTCATAGATCTTCATGCTAATCTCGGCAATAAGTGGTCTAAGATAGCTTCAAGATTACCTGGAAGAACAGATAACGAAATAAAAAACCATTGGAATACTCATATCAAGAAGAAACTTCTTAAGATGGGAATCGATCCTATGACCCATCAACCCCTAAATCAAGAACCTTCTAATATCGATAATTCCAAAACCATTCCGTCCAATCCAGACGATGTCTCAGTGGAACCAAAGACAACTAACACGAAATACGTGGAGATAAGTGTCACGACAACAGAAGAAGAAAGTAGTAGCACGGTTACTGATCAAAACAGTTCGATGGATAATGAAAATCATCTAATTGACAACATTTATGATGATGATGAATTGTTTAGTTACTTATGGTCCGACGAAACTACTAAAGATGAGGCCTCTTGGAGTGATAGTAACTTTGGTGTTGGTGGAACATTATATGACCACAATATCTCCGGCGCCGATGCAGATTTTCCGATATGGTCACCGGAAAGAATCAATGACGAGAAGATGTTTTTGGATTATTGTCAAGACTTTGGTGTTCATGATTTTGGGTTTTGACTGTTCACCATTGACATATTGGCAACTCTATGGAGATGAACACAAGCATTGAGTTGTCATGTTTATACATACGTGGCATATACATATATATATATATGTACATTATATGTAAACATATACACGCATACAAATCATAAACATGTAAGGATAATAAATCCATGTAAAGCAGTAAGGGTGCACCATGGTTTTCAAGTATTATTAATTAGGGTTTGGTAGGATTTCGTCAAAGTCAAGAATACAGATTGAAGTTTACTTTCTTTGTTTTGTATAAATTATTCACATATTCACAAACCGAGGAATATATATTATGAAAATAAGATGAATGTATGTTTCAGTATTAGGGTCCAACTTTACGTTTAAACAAAACTTAAAAAATTGAGACACTAGTTCTCTCCTGCATATCTTTGTATCCTTATCTTTATGTTATAAAATATTTGTATAATTGTGCT
CDS Sequence
Protein Sequence