Gene Details:

  • Gene ID: AT4G25140
  • Gene Symbol: OLE1, OLEO1
  • Gene Name: OLEOSIN 1, oleosin 1
  • Description: oleosin 1;(source:Araport11)
  • TAIR Accession: locus:2117328
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Plant Ontology Annotations:

  • PO:0000037  — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)

Gene Ontology:

  • GO:0012511  — located in — monolayer-surrounded lipid storage body
  • GO:0010344  — acts upstream of or within — seed oilbody biogenesis
  • GO:0003674  — enables — molecular_function
  • GO:0050826  — acts upstream of or within — response to freezing
  • GO:0009845  — acts upstream of or within — seed germination
  • GO:0005739  — located in — mitochondrion
  • GO:0005576  — is active in — extracellular region
  • GO:0019915  — involved in — lipid storage
  • GO:0019953  — involved in — sexual reproduction
  • GO:0019915  — acts upstream of or within — lipid storage

Germplasm Phenotype:

  • CS69011  — Larger oil bodies than wildtype. Seeds have reduced freezing tolerance.
  • CS69015  — Germination rate is 10% of wildtype at 11 days after planting. Enhanced ole1 large oil body phenotype. Irregularly-shaped nuclei at the periphery of the seed cells. Seeds have drastically reduced freezing tolerance.
  • CS69016  — Germination rate is 50% of wildtype at 11 days after planting. Enhanced ole1 large oil body phenotype. Seeds have drastically reduced freezing tolerance.
  • SM_3_29875  — During walking stick stage, aberrant embryo cells contained unusually large oilbodies not observed in WT seeds. Large oilbodies in some cases had 5 micrometers in diameter. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination.
  • SM_3_29875  — ole1 seeds have much larger oil bodies than wild-type. OLE1 deficiency leads to loss of freezing tolerance of Arabidopsis seeds. Treating ole1 seeds with freezing (at -30°C for 1 day) inhibits and delays their germination, although ole1 seeds without freezing treatment germinate normally. Seed oil bodies of ole1 ole2 and ole1 ole3 double mutants are much larger than ole1 mutant. ole1 ole2 and ole1 ole3 seeds hardly germinate. ole1 ole2 and ole1 ole3 double mutants seeds do not germinate when treated with freezing condition (at -30°C for 1 day).
  • ole1 ole2  — Oil bodies of ole1 ole2 double mutant are much larger than ole1 and ole2 single mutants. ole1 ole2 seeds hardly germinate. None of them that are treated with freezing (at -30°C for 1 day) germinate.
  • ole1 ole3  — Oil bodies of ole1 ole3 double mutant are much larger than ole1 and ole3 single mutants. ole1 ole3 seeds hardly germinate. None of them that are treated with freezing (at -30°C for 1 day) germinate.

Literature:

Sequence:

cDNA Sequence
  • >AT4G25140.1 ATATACACATCTTTTTGATCAATCTCTCATTCAAAATCTCATTCTCTCTAGTAAACAAGAACAAAAAAATGGCGGATACAGCTAGAGGAACCCATCACGATATCATCGGCAGAGACCAGTACCCGATGATGGGCCGAGACCGAGACCAGTACCAGATGTCCGGACGAGGATCTGACTACTCCAAGTCTAGGCAGATTGCTAAAGCTGCAACTGCTGTCACAGCTGGTGGTTCCCTCCTTGTTCTCTCCAGCCTTACCCTTGTTGGAACTGTCATAGCTTTGACTGTTGCAACACCTCTGCTCGTTATCTTCAGCCCAATCCTTGTCCCGGCTCTCATCACAGTTGCACTCCTCATCACCGGTTTTCTTTCCTCTGGAGGGTTTGGCATTGCCGCTATAACCGTTTTCTCTTGGATTTACAAGTACGCAACGGGAGAGCACCCACAGGGATCAGACAAGTTGGACAGTGCAAGGATGAAGTTGGGAAGCAAAGCTCAGGATCTGAAAGACAGAGCTCAGTACTACGGACAGCAACATACTGGTGGGGAACATGACCGTGACCGTACTCGTGGTGGCCAGCACACTACTTAAGTTACCCCACTGATGTCATCGTCATAGTCCAATAACTCCAATGTCGGGGAGTTAGTTTATGAGGAATAAAGTGTTTAGAATTTGATCAGGGGGAGATAATAAAAGCCGAGTTTGAATCTTTTTGTTATAAGTAATGTTTATGTGTGTTTCTATATGTTGTCAAATGGTACCATGTTTTTTTTCCTCTCTTTTTGTAACTTGCAAGTGTTGTGTTGTACTTTATTTGGCTTCTTTGTAAGTTGGTAACGGTGGTCTATATATGGAAAAGGTCTTGTTTTGTTAAACTTATGTTAGTTAACTGGATTCGTCTTTAACCAC
CDS Sequence
Protein Sequence