Gene Details:
- Gene ID: AT4G26220
- Gene Symbol: CCoAOMT7
- Gene Name: caffeoyl coenzyme A ester O-methyltransferase 7
- Description: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
- TAIR Accession: locus:2136799
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
Gene Ontology:
- GO:0042409 — enables — caffeoyl-CoA O-methyltransferase activity
- GO:0008757 — enables — S-adenosylmethionine-dependent methyltransferase activity
- GO:0005829 — located in — cytosol
Function-related keywords:
Literature:
- Plant O-methyltransferases: molecular analysis, common signature and classification. DOI: 10.1023/a:1005939803300 ; PMID: 9484457
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. DOI: 10.1016/s0031-9422(03)00517-x ; PMID: 14568076
- Genome-wide characterization of the lignification toolbox in Arabidopsis. DOI: 10.1104/pp.103.026484 ; PMID: 14612585
- Comparative analysis of expressed sequence tags from Sesamum indicum and Arabidopsis thaliana developing seeds. DOI: 10.1023/b:plan.0000004304.22770.e9 ; PMID: 14682612
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Plant body weight-induced secondary growth in Arabidopsis and its transcription phenotype revealed by whole-transcriptome profiling. DOI: 10.1104/pp.104.038844 ; PMID: 15194820
- CINNAMYL ALCOHOL DEHYDROGENASE-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. DOI: 10.1105/tpc.105.030767 ; PMID: 15937231
- Light, the circadian clock, and sugar perception in the control of lignin biosynthesis. DOI: 10.1093/jxb/eri162 ; PMID: 15878986
- The Arabidopsis thaliana transcriptome in response to Agrobacterium tumefaciens. DOI: 10.1094/MPMI-19-0665 ; PMID: 16776300
- Transcription factor AtDOF4;2 affects phenylpropanoid metabolism in Arabidopsis thaliana. DOI: 10.1111/j.1469-8137.2007.02129.x ; PMID: 17635218
- Transcriptomic analysis of Arabidopsis developing stems: a close-up on cell wall genes. DOI: 10.1186/1471-2229-9-6 ; PMID: 19149885
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- Modifications in lignin and accumulation of phenolic glucosides in poplar xylem upon down-regulation of caffeoyl-coenzyme A O-methyltransferase, an enzyme involved in lignin biosynthesis. DOI: 10.1074/jbc.M006915200 ; PMID: 10934215
- Plant O-methyltransferases: molecular analysis, common signature and classification. DOI: 10.1023/a:1005939803300 ; PMID: 9484457
Sequence:
cDNA Sequence
- >AT4G26220.1 AAAAAAGGAAGAAAATCCTATATTTTTGACAATTGTCTGAAAATACGATTAGGTTCAGAGTATTTCAACGTTGTCTCTGTCATTTGTCTATCGCAATTTCGCATAAAAGCAAGCCTTGTAGGTGTAGAAGCCATCACACCAGATTGTAGTGGATGATCGGAAACTAAGACTTCAGTCATCTGAGACTTTACAGTGTTTGAGGAACGAAGATTGTGAGACACAATGGCTAAGGATGAAGCCAAGGGATTGCTGAAAAGTGAAGAGCTCTATAAATATATACTGGAGACTAGTGTGTACCCACGCGAGCCAGAGGTTCTCAGGGAGCTTAGGAACATTACTCATAACCACCCTCAAGCTGGTATGGCTACTGCACCAGACGCTGGCCAGTTGATGGGGATGCTGCTGAATCTGGTAAATGCAAGAAAGACTATCGAGGTTGGGGTTTTCACTGGATACTCTCTTCTCCTCACTGCTCTTACGCTACCAGAAGATGGCAAGGTTATCGCCATTGACATGAATAGAGACTCGTATGAAATAGGATTGCCGGTTATAAAGAAAGCTGGTGTTGAACACAAAATTGATTTCAAAGAGTCTGAAGCTCTTCCAGCCCTCGACGAGCTTTTAAACAATAAAGTGAATGAGGGTGGATTCGACTTCGCATTTGTGGATGCAGACAAGCTGAATTATTGGAACTATCATGAGAGGCTTATTAGATTGATCAAGGTTGGTGGGATCATAGTGTATGATAACACTCTCTGGGGAGGATCAGTTGCTGAACCGGACTCGTCCACGCCCGAGTGGAGGATAGAAGTCAAGAAAGCAACCCTCGAGCTGAACAAGAAACTCTCGGCTGATCAGCGTGTGCAGATCTCGCAAGCTGCGCTTGGCGATGGTATCACTATTTGCAGGAGGTTATATTGAGCGAGTATTGTTGTTCTTTGTGATCTTTAGGGTCATATGATTGTGAGCCCTTTATATTGAGCTATTGTGATGCAAGAGTGTTATTGTTCTATGTGATATTTTGGTTCCTGTGTGAATGTGAACCTTTTCTATCAAGTTTGTGGATTTCTTCAAATTTCAAGATTATAACAGACAGTT
CDS Sequence
Protein Sequence