Gene Details:
- Gene ID: AT4G26320
- Gene Symbol: AGP13
- Gene Name: arabinogalactan protein 13
- Description: arabinogalactan protein 13;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0000263 — non-hair root epidermal cell — atrichoblast (exact), atricoblasto (Spanish, exact), 非毛根形成細胞、アトリコブラスト (Japanese, exact), non-hair cell (broad)
Function-related keywords:
Literature:
- Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis. DOI: 10.1104/pp.010884 ; PMID: 12068095
- Using genomic resources to guide research directions. The arabinogalactan protein gene family as a test case. DOI: 10.1104/pp.003459 ; PMID: 12177459
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- Development and evaluation of an Arabidopsis whole genome Affymetrix probe array. DOI: 10.1111/j.1365-313X.2004.02061.x ; PMID: 15086809
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- Post-translational modifications of arabinogalactan-peptides of Arabidopsis thaliana. Endoplasmic reticulum and glycosylphosphatidylinositol-anchor signal cleavage sites and hydroxylation of proline. DOI: 10.1074/jbc.M407594200 ; PMID: 15322080
- The potassium-dependent transcriptome of Arabidopsis reveals a prominent role of jasmonic acid in nutrient signaling. DOI: 10.1104/pp.104.046482 ; PMID: 15347784
- AtFLA11, a fasciclin-like arabinogalactan-protein, specifically localized in sclerenchyma cells. DOI: 10.1271/bbb.69.1963 ; PMID: 16244449
- A putative Arabidopsis nucleoporin, AtNUP160, is critical for RNA export and required for plant tolerance to cold stress. DOI: 10.1128/MCB.01063-06 ; PMID: 17030626
- Plastic and adaptive gene expression patterns associated with temperature stress in Arabidopsis thaliana. DOI: 10.1038/sj.hdy.6800975 ; PMID: 17473866
- Arabidopsis AAL-toxin-resistant mutant atr1 shows enhanced tolerance to programmed cell death induced by reactive oxygen species. DOI: 10.1016/j.bbrc.2008.08.056 ; PMID: 18725200
- A gene regulatory network for root epidermis cell differentiation in Arabidopsis. DOI: 10.1371/journal.pgen.1002446 ; PMID: 22253603
- The C3H-type zinc finger protein GDS1/C3H42 is a nuclear-speckle-localized protein that is essential for normal growth and development in Arabidopsis. DOI: 10.1016/j.plantsci.2016.06.010 ; PMID: 27457991
- The classical arabinogalactan protein gene family of arabidopsis. DOI: 10.1105/tpc.12.9.1751 ; PMID: 11006345
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
Sequence:
cDNA Sequence
- >AT4G26320.1 GTGCTAATAAAGTTTTTGTTCACCAAATACAAAGAATTAAAACAATTCGAAAATGATTAATTGTGTTGATGTGTTAATCAAACTGTAAAGTGATAATTACACAGTTGGCCTTACATGCATCTATGTGTATATATAAACCACAAGTCACAACACATCAAAACACACCACAAAACACTAAACATATAGTCTCTTCGTGCTTTCTCAAGAACCACCTAGAGATAACCCAATGGAGGCAATGAAGATGAGACTCTTTGTGGCGGTTTTGGTGGCAGCGATGGCTTTCTCTGCGGTGCAACAGGCTGCCGCGGTGGAGGCTCCAGCTCCGAGTCCTACCTCCGATGCTTCCTTGGCCATCCCCGCTTTCTTCGCCTCGGTAGCCACTTTGGCCTTTGGGTTTCTCTTCTAGACAAATTTGTTTTTGTCTTTTTAATGTTATAAAAATCATATTCTTGTTTTTTTATTTCGGTTTTCATTCTTATGTACTGTTCTAAGATTTTCCACATTTGAATCAATAAAATTATCTCGGTCACTTTTTTTTTATTCAGCGTAGCTTTGACAAAATCATTTAAAAAAAAGAATGTAGTTTGA
CDS Sequence
Protein Sequence