Gene Details:
- Gene ID: AT4G27170
- Gene Symbol: AT2S4, SESA4
- Gene Name: seed storage albumin 4
- Description: seed storage albumin 4;(source:Araport11)
- TAIR Accession: locus:2136496
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0003674 — enables — molecular_function
- GO:0005576 — located in — extracellular region
- GO:0008150 — involved in — biological_process
Literature:
- Redundant proteolytic mechanisms process seed storage proteins in the absence of seed-type members of the vacuolar processing enzyme family of cysteine proteases. DOI: 10.1105/tpc.005009 ; PMID: 12417707
- Storage protein accumulation in the absence of the vacuolar processing enzyme family of cysteine proteases. DOI: 10.1105/tpc.016378 ; PMID: 14688293
- Comparative analysis of expressed sequence tags from Sesamum indicum and Arabidopsis thaliana developing seeds. DOI: 10.1023/b:plan.0000004304.22770.e9 ; PMID: 14682612
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Expression and function of HD2-type histone deacetylases in Arabidopsis development. DOI: 10.1111/j.1365-313X.2004.02083.x ; PMID: 15144374
- The eight-cysteine motif, a versatile structure in plant proteins. DOI: 10.1016/j.plaphy.2004.03.009 ; PMID: 15191737
- Characterization of a novel putative zinc finger gene MIF1: involvement in multiple hormonal regulation of Arabidopsis development. DOI: 10.1111/j.1365-313X.2005.02626.x ; PMID: 16412086
- Proteomic and transcriptomic analysis of Arabidopsis seeds: molecular evidence for successive processing of seed proteins and its implication in the stress response to sulfur nutrition. DOI: 10.1111/j.1365-313X.2006.02900.x ; PMID: 17059406
- MAIGO2 is involved in exit of seed storage proteins from the endoplasmic reticulum in Arabidopsis thaliana. DOI: 10.1105/tpc.106.046151 ; PMID: 17194767
- Analysis of the Arabidopsis histidine kinase ATHK1 reveals a connection between vegetative osmotic stress sensing and seed maturation. DOI: 10.1105/tpc.107.055871 ; PMID: 18441212
- Identification, cloning and characterization of sis7 and sis10 sugar-insensitive mutants of Arabidopsis. DOI: 10.1186/1471-2229-8-104 ; PMID: 18854047
- Synergistic repression of the embryonic programme by SET DOMAIN GROUP 8 and EMBRYONIC FLOWER 2 in Arabidopsis seedlings. DOI: 10.1093/jxb/err383 ; PMID: 22162868
- Sulfur deficiency-induced genes affect seed protein accumulation and composition under sulfate deprivation. DOI: 10.1093/plphys/kiab386 ; PMID: 34618078
Sequence:
cDNA Sequence
- >AT4G27170.1 ACTCAAACAAAAAACATACACAAGTAATTAACTAACAACAAATGGCGAACAAGCTCTTCCTCGTCTGCGCAGCTCTCGCCCTGTGTTTCATCCTCACCAACGCTTCCGTCTATCGCACCGTTGTCGAGTTCGACGAAGATGACGCCAGTAACCCCATAGGCCCAATACAGAAATGTCAGAAGGAGTTTCAGCAAGACCAGCACCTAAGAGCTTGCCAGAGATGGATGCGCAAGCAAATGTGGCAAGGACGTGGTGGTGGTCCTTCCCTCGACGATGAGTTCGATATGGAAGACGACATCGAGAACCCGCAGAGACGACAGCTACTCCAGAAGTGCTGCAGCGAGCTTCGCCAAGAAGAGCCAGTTTGCGTTTGCCCCACCTTGAGACAAGCTGCCAAGGCCGTTAGATTCCAGGGACAGCAACACCAACCAGAGCAAGTCAGGAAAATTTACCAGGCAGCTAAGTACTTGCCTAACATTTGCAAAATCCAGCAAGTTGGTGTTTGCCCCTTCCAGATCCCTTCAATCCCTTCTTACTACTAAATTCCAGAGAAGTGTGAGCGTGTGGTTGTTGATATATGTTAACACCACATCTCGCCTTGTGTTTTTATAAAAAAATAAGCTTTGGGATGTTTGAGGCTAATGTAATAATTAGCACTACAACGTAATAAATAAGAGAGGTTTGTTTA
CDS Sequence
Protein Sequence