Gene Details:
- Gene ID: AT4G28510
- Gene Symbol: ATPHB1, PHB1
- Gene Name: prohibitin 1, prohibitin 1
- Description: prohibitin 1;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Literature:
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- The age of the Arabidopsis thaliana genome duplication. DOI: 10.1023/a:1023001130337 ; PMID: 12777046
- Mitochondrial complex I from Arabidopsis and rice: orthologs of mammalian and fungal components coupled with plant-specific subunits. DOI: 10.1016/s0005-2728(03)00045-8 ; PMID: 12837548
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Isolation of intact vacuoles and proteomic analysis of tonoplast from suspension-cultured cells of Arabidopsis thaliana. DOI: 10.1093/pcp/pch099 ; PMID: 15215502
- The hydrophobic proteome of mitochondrial membranes from Arabidopsis cell suspensions. DOI: 10.1016/j.phytochem.2004.03.028 ; PMID: 15276431
- Arabidopsis NRP1 and NRP2 encode histone chaperones and are required for maintaining postembryonic root growth. DOI: 10.1105/tpc.106.046490 ; PMID: 17122067
- Resolving and identifying protein components of plant mitochondrial respiratory complexes using three dimensions of gel electrophoresis. DOI: 10.1021/pr700595p ; PMID: 18189341
- The Arabidopsis PHB3 is a pleiotropic regulator for plant development. DOI: 10.1080/15592324.2019.1656036 ; PMID: 31429630
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- The hydrophobic proteome of mitochondrial membranes from Arabidopsis cell suspensions. DOI: 10.1016/j.phytochem.2004.03.028 ; PMID: 15276431
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Resolving and identifying protein components of plant mitochondrial respiratory complexes using three dimensions of gel electrophoresis. DOI: 10.1021/pr700595p ; PMID: 18189341
Sequence:
cDNA Sequence
- >AT4G28510.1 TTCATTTCCAAAACGGAAAATGTGACACCGTCCCATTTACTCCAATAGAAGTCTGAGCTTAAACCCTAAACCCCTTTCTCCACGATCTTCCTTTTCCTCTCTCTGCGACTTGAAGCAAAGTTTCCAGAAAAAGAGATGAACAACGTCAAAGTTCCAAAGATACCAGGTGGTGGTGCCATTTCGACGTTGCTTAAGGTTGGGATTATTGGTGGGCTTGGTCTCTATGGTGCTACGCACAGTCTCTACAATGTTGAAGGAGGACATCGAGCCATCATGTTCAATCGTTTAGTCGGTATTAAAGATAAGGTTTACCCTGAGGGTACACACCTTATGATTCCTTGGTTTGAAAGGCCGGTCATCTATGACGTTCGTGCTCGACCTTACCTTGTTGAGAGTACATCCGGAAGCCGTGATCTTCAGATGGTGAAAATTGGGCTTAGGGTTCTCACACGTCCCATGGCAGACCAGTTACCTGAAATCTACAGAAGCCTTGGTGAGAACTACAGCGAGAGAGTTCTACCTTCTATAATCAACGAGACTTTGAAAGCTGTGGTTGCTCAGTACAATGCAAGCCAGCTTATTACTCAGAGAGAGGCGGTCAGTAGGGAGATCAGGAAGATTCTGACTGAACGAGCAGCAAACTTCAATGTTGCGCTTGACGATGTGTCCATCACAAACCTGACATTCGGGAAGGAGTTCACAGCTGCCATTGAAGCAAAGCAGGTGGCGGCTCAAGAGGCTGAGCGGGCTAAGTTCATTGTTGAGAAGGCCGAACAAGACAAGAGAAGTGCTGTTATCCGCGCCCAGGGAGAAGCCAAGAGTGCTCAGCTCATTGGTCAAGCAATTGCAAACAACCAAGCGTTTATCACGCTCAGGAAGATCGAGGCTGCAAGAGAGATTGCACAGACCATAGCAAACTCGGCGAACAAGGTTTACTTGAGCTCAGACGATCTTTTGCTTAACCTACAAGGGATGAATTTGGATGTTGATGCAAAGAACTAGAGAGGTTTCTTAAGTAAAACTGCATGTGGGTCATTTCGTCTTTTAAGTTCCTAGAATCCGTTGGAACAAAAGCTTGATTTGTACTACTAAATACTACTTTTAAAATTCTTGGGATCAGTCTATCTCAAGGTGAAAGTTGAAAAAGAAGATACTGTCTTGCTGAATGAGTTAATTGTAATAAACTTGTCGTTTGGGGGAGAAAAACACTTGCATTTGGATTTACCATAGGCATTTGCATGGTTATTGCTTATACGAGTGTCAGTGTCCCGATACACCTTTTGTATAAAATTGATCATGAAGATGTGTATTAATTGGTAAATATTGATAGTATATCTATATGTTGGCA
CDS Sequence
Protein Sequence