Gene Details:
- Gene ID: AT4G29280
- Gene Symbol: LCR22
- Gene Name: low-molecular-weight cysteine-rich 22
- Description: low-molecular-weight cysteine-rich 22;(source:Araport11)
- TAIR Accession: locus:2118214
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0003674 — enables — molecular_function
- GO:0006952 — acts upstream of or within — defense response
- GO:0005576 — located in — extracellular region
Literature:
- Two large Arabidopsis thaliana gene families are homologous to the Brassica gene superfamily that encodes pollen coat proteins and the male component of the self-incompatibility response. DOI: 10.1023/a:1010664704926 ; PMID: 11437247
- Genome organization of more than 300 defensin-like genes in Arabidopsis. DOI: 10.1104/pp.105.060079 ; PMID: 15955924
Sequence:
cDNA Sequence
- >AT4G29280.1 ATGGCTAAGATATCATGTTCTTCTTTCTTCGTACTCATGCTAGTGTTTTCAGTTTTTTCATTGGTTGAGAAGGCTAAAGGAGATGAACGTTGTACCATAATCATTCATCCAGGATCTCCATGTGACCCTTCTGATTGTGTTCAGTACTGCTATGCGGAGTACAATGGAGTTGGAAAATGTATTGCATCCAAACCTGGTAGAAGTGCTAATTGTATGTGTACTTATAATTGTTAAAGAGACAAATTCTTAATAA
CDS Sequence
Protein Sequence