Gene Details:
- Gene ID: AT5G02960
- Gene Symbol: uS12y
- Gene Name: Ribosomal Protein uS12y
- Description: Ribosomal protein S12/S23 family protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- The Arabidopsis root transcriptome by serial analysis of gene expression. Gene identification using the genome sequence. DOI: 10.1104/pp.103.030536 ; PMID: 14730065
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- The maize root transcriptome by serial analysis of gene expression. DOI: 10.1104/pp.104.057638 ; PMID: 15965024
- The Arabidopsis thaliana transcriptome in response to Agrobacterium tumefaciens. DOI: 10.1094/MPMI-19-0665 ; PMID: 16776300
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Differential SAGE analysis in Arabidopsis uncovers increased transcriptome complexity in response to low temperature. DOI: 10.1186/1471-2164-9-434 ; PMID: 18808718
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- A proteomics approach identifies novel proteins involved in gravitropic signal transduction. DOI: 10.3732/ajb.1200339 ; PMID: 23281391
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
Sequence:
cDNA Sequence
- >AT5G02960.1 ATATTAAGAGTCACTGCCTTCACTAGGTTTAGGGTTTTCTCAGCCGCTTAAGAGCTTATCATCTTTGTGCTTCCTGCAAATAGCTCTTTGCTGTTGATCTTTCTCCTCCATCAACAAACATGGGTAAGACACGTGGTATGGGAGCTGGGCGTAAGCTGAAGAGACTCCGAATTAACCAGAGGTGGGCTGACAAGCAGTACAAGAAGTCTCACTTGGGAAATGAGTGGAAGAAGCCTTTTGCTGGTTCTTCTCACGCTAAAGGAATTGTTCTTGAGAAAATTGGTATTGAGGCTAAGCAGCCTAACTCTGCTATCCGTAAGTGTGCTAGAGTTCAGCTTATCAAGAATGGAAAGAAGATTGCTGCCTTTGTCCCCAATGATGGTTGTTTGAACTACATCGAGGAAAACGATGAGGTCTTGATTGCTGGATTTGGTCGTAAGGGTCACGCTGTGGGAGATATTCCCGGAGTTAGGTTCAAGGTCGTGAAGGTTTCTGGTGTTTCACTCTTGGCCCTCTTCAAGGAAAAGAAGGAGAAGCCAAGATCTTAAGCAACCCGTACAAAAAGCTTCAAGCTTTTGATATGGTTTTTGATAGTTCAGTTTAAGTCTTGTTCTGTTCTACTTTATGTTTCAAGAACTTGATTTTGTGTTACATTTTATGAGTTTTTGAATTAAGACATGATCGTTTAATGTTATTGGTGTTTAATCAATTTACTCTTTTAACTTATAAGCCTCATCTTCAGTTGCGAC
CDS Sequence
Protein Sequence