Gene Details:
- Gene ID: AT5G04950
- Gene Symbol: ATNAS1, NAS1
- Gene Name: ARABIDOPSIS THALIANA NICOTIANAMINE SYNTHASE 1, nicotianamine synthase 1
- Description: nicotianamine synthase 1;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
Function-related keywords:
- root , shoot system , root
Literature:
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- Expression profiles of Arabidopsis thaliana in mineral deficiencies reveal novel transporters involved in metal homeostasis. DOI: 10.1074/jbc.M309338200 ; PMID: 13129917
- Microarray analysis of E2Fa-DPa-overexpressing plants uncovers a cross-talking genetic network between DNA replication and nitrogen assimilation. DOI: 10.1242/jcs.00715 ; PMID: 12953064
- Comparative microarray analysis of Arabidopsis thaliana and Arabidopsis halleri roots identifies nicotianamine synthase, a ZIP transporter and other genes as potential metal hyperaccumulation factors. DOI: 10.1046/j.1365-313x.2003.01960.x ; PMID: 14690510
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Transcriptional profiling by cDNA-AFLP and microarray analysis reveals novel insights into the early response to ethylene in Arabidopsis. DOI: 10.1111/j.1365-313X.2004.02156.x ; PMID: 15272873
- The essential basic helix-loop-helix protein FIT1 is required for the iron deficiency response. DOI: 10.1105/tpc.104.024315 ; PMID: 15539473
- Loss of TIP1;1 aquaporin in Arabidopsis leads to cell and plant death. DOI: 10.1111/j.1365-313X.2004.02265.x ; PMID: 15584951
- Analysis of sequence, map position, and gene expression reveals conserved essential genes for iron uptake in Arabidopsis and tomato. DOI: 10.1104/pp.104.047233 ; PMID: 15531708
- Zinc-dependent global transcriptional control, transcriptional deregulation, and higher gene copy number for genes in metal homeostasis of the hyperaccumulator Arabidopsis halleri. DOI: 10.1104/pp.105.076232 ; PMID: 16844841
- Large expression differences in genes for iron and zinc homeostasis, stress response, and lignin biosynthesis distinguish roots of Arabidopsis thaliana and the related metal hyperaccumulator Thlaspi caerulescens. DOI: 10.1104/pp.106.082073 ; PMID: 16998091
- The analysis of Arabidopsis nicotianamine synthase mutants reveals functions for nicotianamine in seed iron loading and iron deficiency responses. DOI: 10.1104/pp.109.136374 ; PMID: 19304929
- Ethylene and nitric oxide involvement in the up-regulation of key genes related to iron acquisition and homeostasis in Arabidopsis. DOI: 10.1093/jxb/erq203 ; PMID: 20627899
- Transcriptome analysis by GeneTrail revealed regulation of functional categories in response to alterations of iron homeostasis in Arabidopsis thaliana. DOI: 10.1186/1471-2229-11-87 ; PMID: 21592396
- Vacuolar nicotianamine has critical and distinct roles under iron deficiency and for zinc sequestration in Arabidopsis. DOI: 10.1105/tpc.111.095042 ; PMID: 22374397
- Heavy Metals Need Assistance: The Contribution of Nicotianamine to Metal Circulation Throughout the Plant and the Arabidopsis NAS Gene Family. DOI: 10.3389/fpls.2011.00069 ; PMID: 22639605
- Nicotianamine functions in the Phloem-based transport of iron to sink organs, in pollen development and pollen tube growth in Arabidopsis. DOI: 10.1105/tpc.112.099077 ; PMID: 22706286
- Abscisic acid alleviates iron deficiency by promoting root iron reutilization and transport from root to shoot in Arabidopsis. DOI: 10.1111/pce.12203 ; PMID: 24111973
- Rice nicotianamine synthase localizes to particular vesicles for proper function. DOI: 10.4161/psb.28660 ; PMID: 24704865
- ZAT10 plays dual roles in cadmium uptake and detoxification in Arabidopsis. DOI: 10.3389/fpls.2022.994100 ; PMID: 36110357
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- Map-based cloning of chloronerva, a gene involved in iron uptake of higher plants encoding nicotianamine synthase. DOI: 10.1073/pnas.96.12.7098 ; PMID: 10359845
- Isolation, characterization and cDNA cloning of nicotianamine synthase from barley. A key enzyme for iron homeostasis in plants. DOI: 10.1046/j.1432-1327.1999.00717.x ; PMID: 10491178
Sequence:
cDNA Sequence
- >AT5G04950.1 CGAGATCCACCACTTATTATTCATAACGTATATGAATCGAATCATTGATAGATAAATAATTTCAGCCAAGAATTGACCCCACGAGTGCCAATAAATAACGACCCTTAGCGAGGGTTAAAGCCACAACACAAAATTTGTTCAAAGTCTAAAAAAGATTATTATTACTTATCTTCTCCCCTGAAATAACCTCATAGTGTCGATATGGCTTGCCAAAACAATCTCGTTGTGAAGCAAATCATCGACTTGTACGACCAAATCTCAAAGCTCAAGAGCTTAAAACCTTCCAAAAATGTCGACACTTTGTTCGGACAACTCGTGTCCACGTGCTTACCCACGGATACAAACATCGATGTCACAAATATGTGTGAAGAAGTCAAAGACATGAGAGCTAATCTCATCAAGCTTTGTGGTGAAGCCGAAGGTTATTTAGAGCAACACTTCTCCACAATTTTGGGATCTTTACAAGAAGACCAAAACCCACTTGACCATTTACACATCTTTCCTTACTACTCCAACTACCTCAAGCTAGGCAAGCTCGAGTTCGATCTCCTGAGCCAACACTCAAGCCATGTCCCCACCAAGATTGCCTTCGTGGGTTCGGGTCCGATGCCTCTCACATCCATCGTATTGGCCAAGTTTCACCTCCCCAACACGACGTTCCACAACTTTGACATCGACTCACACGCAAACACACTCGCTTCAAACCTCGTCTCTCGCGACCCGGACCTCTCAAAACGCATGATCTTCCACACAACGGACGTACTAAACGCAACCGAAGGCCTTGACCAATATGACGTCGTTTTCTTAGCGGCGCTTGTAGGGATGGACAAAGAGTCAAAGGTCAAAGCCATCGAGCACTTGGAGAAACACATGGCTCCTGGAGCTGTTCTTATGCTAAGGAGTGCTCATGCTCTCAGAGCTTTCTTATATCCAATCGTTGACTCGTCTGATCTCAAAGGCTTTCAACTCTTGACCATCTATCATCCAACCGATGACGTGGTTAACTCGGTTGTGATCGCACGTAAGCTCGGTGGTCCGACCACGCCCGGGGTTAATGGTACTCGTGGATGCATGTTTATGCCTTGTAACTGCTCCAAGATTCACGCGATCATGAACAACCGTGGTAAGAAGAATATGATCGAGGAGTTTAGTGCCATCGAGTAAACAAACAATTAATAAAACACATCTCTTTTCTTAAGATTGTGTTAATGTTTTTGTCTTATATTAACTGCTCTTTTCATTTCATGTCTTGTGTGTGTGTGGCTACGCTTATTAAGTGTTAAGTTTGTGAATTTTGAGTTCTTTGATCTTTGTTATGAATGAAAAAGATACCGAACATTTTGTTTGTTGTACTTTTTATATATTATCATTAATAAAAAAGCATATCTTGAGATCCGCA
CDS Sequence
Protein Sequence