Gene Details:
- Gene ID: AT5G06170
- Gene Symbol: ATSUC9, SUC9
- Gene Name: sucrose-proton symporter 9, sucrose-proton symporter 9
- Description: sucrose-proton symporter 9;(source:Araport11)
- TAIR Accession: locus:2160732
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
Gene Ontology:
- GO:0051119 — enables — sugar transmembrane transporter activity
- GO:0005886 — is active in — plasma membrane
- GO:0005773 — is active in — vacuole
- GO:0009908 — acts upstream of or within — flower development
- GO:0042951 — enables — arbutin transmembrane transporter activity
- GO:0042950 — enables — salicin transmembrane transporter activity
- GO:0005985 — involved in — sucrose metabolic process
- GO:0009909 — acts upstream of or within — regulation of flower development
- GO:0008515 — enables — sucrose transmembrane transporter activity
- GO:0034219 — acts upstream of or within — carbohydrate transmembrane transport
- GO:0015770 — involved in — sucrose transport
- GO:0042946 — acts upstream of or within — glucoside transport
- GO:0008506 — enables — sucrose:proton symporter activity
- GO:0005364 — enables — maltose:proton symporter activity
- GO:0015768 — involved in — maltose transport
- GO:0005886 — located in — plasma membrane
Function-related keywords:
Literature:
- The companion cell-specific Arabidopsis disaccharide carrier AtSUC2 is expressed in nematode-induced syncytia. DOI: 10.1104/pp.008037 ; PMID: 12529515
- The AtSUC5 sucrose transporter specifically expressed in the endosperm is involved in early seed development in Arabidopsis. DOI: 10.1111/j.1365-313X.2005.02496.x ; PMID: 16146522
- Genetic subtraction profiling identifies genes essential for Arabidopsis reproduction and reveals interaction between the female gametophyte and the maternal sporophyte. DOI: 10.1186/gb-2007-8-10-r204 ; PMID: 17915010
- Arabidopsis sucrose transporter AtSUC1 is important for pollen germination and sucrose-induced anthocyanin accumulation. DOI: 10.1104/pp.108.118992 ; PMID: 18359840
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Evolution of plant sucrose uptake transporters. DOI: 10.3389/fpls.2012.00022 ; PMID: 22639641
- Root exudation of phytochemicals in Arabidopsis follows specific patterns that are developmentally programmed and correlate with soil microbial functions. DOI: 10.1371/journal.pone.0055731 ; PMID: 23383346
- Three MYB transcription factors control pollen tube differentiation required for sperm release. DOI: 10.1016/j.cub.2013.05.021 ; PMID: 23791732
- Sucrose Transporter AtSUC9 Mediated by a Low Sucrose Level is Involved in Arabidopsis Abiotic Stress Resistance by Regulating Sucrose Distribution and ABA Accumulation. DOI: 10.1093/pcp/pcv082 ; PMID: 26063392
- The AtSUC5 sucrose transporter specifically expressed in the endosperm is involved in early seed development in Arabidopsis. DOI: 10.1111/j.1365-313X.2005.02496.x ; PMID: 16146522
- Arabidopsis sucrose transporter AtSUC9. High-affinity transport activity, intragenic control of expression, and early flowering mutant phenotype. DOI: 10.1104/pp.106.089003 ; PMID: 17098854
Sequence:
cDNA Sequence
- >AT5G06170.1 ATGAGTGACATCCAAGCAAAAGAAGATGCGGCGCCTGTTGATAGACAGTCTTCTTCGTCGGTTGTGGTTCCTGATGAGCCGTCACCTCTAAGAAAGATGATATCAGTGGCTTCTATCGCAGCCGGTATACAGTTTGGTTGGGCTCTTCAGCTTTCTCTCCTAACCCCATACGTTCAGCTTCTCGGAGTCCCACACAAATGGTCATCTTTCATATGGCTATGTGGTCCTATCTCCGGTCTGCTCGTCCAGCCAACCGTCGGTTACTTCAGCGACCGATGCAAGTCAAGATTCGGTCGTCGTCGACCTTTCATCGCCACTGGTGCCTTGCTTGTTGCCCTTGCTGTTATACTAATTGGATTTGCGGCTGACTTCGGCCACACCATGGGAGATAAACTCGACGAAGCTGTCAAGATAAGAGCCGTTGGTTTCTTCGTTGTCGGTTTCTGGATCCTTGACGTGGCTAACAACACTCTTCAAGGACCTTGCCGTGCTTTTCTTGGTGATTTAGCAGCCGGAGATGCTAAGAAAACTCGAACTGCCAACGCGATTTTCTCTTTCTTCATGGCCGTTGGAAACGTTTTGGGATACGCTGCGGGATCGTACACTAACCTCCACAAGATTTTCCCTTTCACAGTGACTAAAGCATGCGACATCTATTGTGCAAATCTCAAGAGCTGTTTCATTATTTCCATCACTCTCCTCATAGTCCTCACAATCATAGCTCTTTGGTACGTGGAAGACAAGCAATGGTCGCCTAATGCAGATTCCGACAATGAGAAAACTCCCTTCTTTGGCGAGATCTTTGGAGCTTTCAAGGTGATGAAACGTCCAATGTGGATGCTTCTAGCCGTCACGGCCTTGAACTGGATCGCATGGTTTCCTTTTCTTTTATACGATACCGATTGGATGGGTCGTGAAGTGTATGGTGGAGACTCAGCAGGAGATGACAAAATGAAGAAACTATACAACCACGGAATCCAAGTTGGTTCGTTGGGGTTGATGCTTAACTCTATCGTTCTTGGAGTCATGTCCCTTGTTATTGGAGTGATTAGTAAGAAAATTGGAGCTAAAAGGCTTTGGGGAGCTGTGAACATAATCCTCGCGGTGTGTTTGGCAATGACAGTTTTGGTTACTAAAAAGGCTGAGGAGCACCGGAAGATCGCTGGTCGGATGGCCCTTCCTACCAATGCCATCAGAGATGGAGCATTGAGTCTCTTTGCTATTCTTGGAATTCCTCTTGCTATTACATTTAGTATTCCATTTGCATTAGCTTCCATTATTTCAAGCAGTTCCGGTGCCGGTCAAGGACTCTCTCTAGGAGTTTTAAACATGGCAATAGTGATACCACAAATGATTGTATCGTTTGGAGTTGGTCCAATTGATGCGTTATTTGGAGGTGGAAACTTACCTGGATTTGTGGTTGGAGCTATAGCAGCTCTAATCAGCAGTGTTGTGGCACTTACCGTTTTACCTTAA
CDS Sequence
Protein Sequence