Gene Details:
- Gene ID: AT5G06290
- Gene Symbol: 2-Cys Prx B, 2CPB
- Gene Name: 2-cysteine peroxiredoxin B, 2-CYS PEROXIREDOXIN B
- Description: 2-cysteine peroxiredoxin B;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0025034 — leaf — hoja (Spanish, exact), 葉 (Japanese, exact)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
- leaf , vascular leaf , root , guard cell
Literature:
- The function of the chloroplast 2-cysteine peroxiredoxin in peroxide detoxification and its regulation. DOI: NA ; PMID: 11997378
- Divergent light-, ascorbate-, and oxidative stress-dependent regulation of expression of the peroxiredoxin gene family in Arabidopsis. DOI: 10.1104/pp.010017 ; PMID: 12529539
- The age of the Arabidopsis thaliana genome duplication. DOI: 10.1023/a:1023001130337 ; PMID: 12777046
- The water-water cycle is essential for chloroplast protection in the absence of stress. DOI: 10.1074/jbc.M304987200 ; PMID: 12885779
- Resemblance and dissemblance of Arabidopsis type II peroxiredoxins: similar sequences for divergent gene expression, protein localization, and activity. DOI: 10.1104/pp.103.022533 ; PMID: 12913160
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- The antioxidant status of photosynthesizing leaves under nutrient deficiency: redox regulation, gene expression and antioxidant activity in Arabidopsis thaliana. DOI: 10.1111/j.0031-9317.2004.0272.x ; PMID: 15032878
- Specific changes in the Arabidopsis proteome in response to bacterial challenge: differentiating basal and R-gene mediated resistance. DOI: 10.1016/j.phytochem.2004.04.005 ; PMID: 15276439
- The mitochondrial type II peroxiredoxin F is essential for redox homeostasis and root growth of Arabidopsis thaliana under stress. DOI: 10.1074/jbc.M413189200 ; PMID: 15632145
- The MAP kinase substrate MKS1 is a regulator of plant defense responses. DOI: 10.1038/sj.emboj.7600737 ; PMID: 15990873
- The plant multigenic family of thiol peroxidases. DOI: 10.1016/j.freeradbiomed.2004.07.037 ; PMID: 15890615
- The function of peroxiredoxins in plant organelle redox metabolism. DOI: 10.1093/jxb/erj160 ; PMID: 16606633
- A homeodomain leucine zipper gene from Craterostigma plantagineum regulates abscisic acid responsive gene expression and physiological responses. DOI: 10.1007/s11103-006-0023-x ; PMID: 16830180
- The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show and long-term exposure to low temperature. DOI: 10.1111/j.1365-313X.2006.02821.x ; PMID: 16923014
- Regulation of peroxiredoxin expression versus expression of Halliwell-Asada-Cycle enzymes during early seedling development of Arabidopsis thaliana. DOI: 10.1007/s11120-006-9087-3 ; PMID: 16915352
- Rice NTRC is a high-efficiency redox system for chloroplast protection against oxidative damage. DOI: 10.1105/tpc.106.041541 ; PMID: 16891402
- Modifications to the Arabidopsis defense proteome occur prior to significant transcriptional change in response to inoculation with Pseudomonas syringae. DOI: 10.1104/pp.106.086231 ; PMID: 17028151
- Comparative proteomic approaches for the isolation of proteins interacting with thioredoxin. DOI: 10.1002/pmic.200600443 ; PMID: 17163439
- The Arabidopsis thaliana sulfiredoxin is a plastidic cysteine-sulfinic acid reductase involved in the photooxidative stress response. DOI: 10.1111/j.1365-313X.2006.02969.x ; PMID: 17217469
- Alternative and effective proteomic analysis in Arabidopsis. DOI: 10.1002/pmic.200700346 ; PMID: 17828791
- The peroxiredoxin and glutathione peroxidase families in Chlamydomonas reinhardtii. DOI: 10.1534/genetics.107.086041 ; PMID: 18493039
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- NADPH-dependent thioredoxin reductase and 2-Cys peroxiredoxins are needed for the protection of Mg-protoporphyrin monomethyl ester cyclase. DOI: 10.1016/j.febslet.2008.07.006 ; PMID: 18625226
- Comparison of the chloroplast peroxidase system in the chlorophyte Chlamydomonas reinhardtii, the bryophyte Physcomitrella patens, the lycophyte Selaginella moellendorffii and the seed plant Arabidopsis thaliana. DOI: 10.1186/1471-2229-10-133 ; PMID: 20584316
- Functional analysis of the pathways for 2-Cys peroxiredoxin reduction in Arabidopsis thaliana chloroplasts. DOI: 10.1093/jxb/erq218 ; PMID: 20616155
- 2-cysteine peroxiredoxins and thylakoid ascorbate peroxidase create a water-water cycle that is essential to protect the photosynthetic apparatus under high light stress conditions. DOI: 10.1104/pp.114.255356 ; PMID: 25667319
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Natural Variation of Cold Deacclimation Correlates with Variation of Cold-Acclimation of the Plastid Antioxidant System in Arabidopsis thaliana Accessions. DOI: 10.3389/fpls.2016.00305 ; PMID: 27014325
- The redox-sensitive module of cyclophilin 20-3, 2-cysteine peroxiredoxin and cysteine synthase integrates sulfur metabolism and oxylipin signaling in the high light acclimation response. DOI: 10.1111/tpj.13622 ; PMID: 28644561
- Thioredoxin-like2/2-Cys peroxiredoxin redox cascade supports oxidative thiol modulation in chloroplasts. DOI: 10.1073/pnas.1808284115 ; PMID: 30104347
- GSM2, a transaldolase, contributes to reactive oxygen species homeostasis in Arabidopsis. DOI: 10.1007/s11103-020-01022-x ; PMID: 32564178
- The Functional Relationship between NADPH Thioredoxin Reductase C, 2-Cys Peroxiredoxins, and m-Type Thioredoxins in the Regulation of Calvin-Benson Cycle and Malate-Valve Enzymes in Arabidopsis. DOI: 10.3390/antiox12051041 ; PMID: 37237907
- The function of the chloroplast 2-cysteine peroxiredoxin in peroxide detoxification and its regulation. DOI: NA ; PMID: 11997378
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- The function of peroxiredoxins in plant organelle redox metabolism. DOI: 10.1093/jxb/erj160 ; PMID: 16606633
- The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show and long-term exposure to low temperature. DOI: 10.1111/j.1365-313X.2006.02821.x ; PMID: 16923014
- Modifications to the Arabidopsis defense proteome occur prior to significant transcriptional change in response to inoculation with Pseudomonas syringae. DOI: 10.1104/pp.106.086231 ; PMID: 17028151
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. DOI: 10.1016/j.phytochem.2008.04.007 ; PMID: 18538804
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequence:
cDNA Sequence
- >AT5G06290.1 ATTGATTACTATTTTTGATGTGAAGATTAGATGGAAATATATTCGGAAATCCAACCAGCCTAAAAATAGATTTTGATTTAATTATCAAAGTATGATCATCAACACGGTGTCGTTCCGGTTCATCGAACATTCCACTTCTTTCTTCTTGTCTGAAAAATCTAGAAGAGCAGCTATTTGGTTTCTCTATCCGATTCGTCTCTCTCACGCCCTCACGTTTATCCACCTCATCCTCAAACCAAACCACAAGACCTCTTTTTTAAGTAACCAATCACAGAGAGATAGAGAGAGAGAACAGAGTCAATGTCAATGGCGTCTATAGCTTCTTCTTCTTCCACCACCCTACTCTCTTCCTCTAGGGTTCTTCTTCCCTCCAAGTCTTCTCTTTTATCTCCTACCGTCTCTTTCCCCAGAATCATACCCTCTTCCTCGGCATCATCCTCTTCTCTCTGTTCCGGGTTCTCCAGTCTCGGTTCCCTCACCACCAACCGCTCCGCCTCACGCCGGAACTTCGCCGTCAAGGCTCAGGCTGATGATTTACCACTGGTCGGTAATAAGGCGCCTGATTTTGAAGCTGAGGCAGTTTTTGATCAAGAGTTCATAAAGGTGAAGCTCTCTGAGTACATTGGCAAAAAGTATGTTATTCTATTCTTCTACCCTTTGGACTTCACTTTTGTCTGCCCCACTGAGATTACTGCCTTCAGTGACCGTTATGAAGAATTTGAGAAGCTAAACACCGAAGTATTAGGGGTCTCTGTCGACAGTGTGTTCTCGCATCTTGCGTGGGTCCAAACAGACAGAAAGTCGGGAGGGCTCGGTGATCTGAATTATCCTCTTGTTTCGGATATCACTAAATCCATTTCAAAATCGTTTGGAGTGCTCATCCCTGATCAGGGCATTGCACTGAGAGGGCTTTTCATCATAGACAAGGAAGGAGTCATTCAGCATTCCACCATCAACAACCTCGGTATTGGCCGAAGTGTTGATGAGACAATGAGAACCCTCCAGGCATTACAGTATGTTCAAGAAAACCCGGATGAAGTGTGCCCTGCGGGATGGAAGCCAGGGGAGAAATCAATGAAACCTGACCCCAAGCTCAGCAAAGAATACTTTTCAGCTATCTAGAGGCTAAGATTGAACACATGTTTGGTGAAAATTAGCAATCAGAGTTGTTTTATTCGTCTTTTCAAAGTTGGAGCAGAGTTGTTATTTTTAGCCAAAGAACCTTTGTATCTATCTCATCTTTCTCCTGTTTCTGCTATGTGATTCTCCTTAAATTGAATCAAAAATAAAGAAATCCTTCTTTTCTTTTGCCAATATTTATGTCTTTCACTTGTGT
- >AT5G06290.2 ATTGATTACTATTTTTGATGTGAAGATTAGATGGAAATATATTCGGAAATCCAACCAGCCTAAAAATAGATTTTGATTTAATTATCAAAGTATGATCATCAACACGGTGTCGTTCCGGTTCATCGAACATTCCACTTCTTTCTTCTTGTCTGAAAAATCTAGAAGAGCAGCTATTTGGTTTCTCTATCCGATTCGTCTCTCTCACGCCCTCACGTTTATCCACCTCATCCTCAAACCAAACCACAAGACCTCTTTTTTAAGTAACCAATCACAGAGAGATAGAGAGAGAGAACAGAGTCAATGTCAATGGCGTCTATAGCTTCTTCTTCTTCCACCACCCTACTCTCTTCCTCTAGGGTTCTTCTTCCCTCCAAGTCTTCTCTTTTATCTCCTACCGTCTCTTTCCCCAGAATCATACCCTCTTCCTCGGCATCATCCTCTTCTCTCTGTTCCGGGTTCTCCAGTCTCGGTTCCCTCACCACCAACCGCTCCGCCTCACGCCGGAACTTCGCCGTCAAGGCTCAGGCTGATGATTTACCACTGGTCGGTAATAAGGCGCCTGATTTTGAAGCTGAGGCAGTTTTTGATCAAGAGTTCATAAAGGTGAAGCTCTCTGAGTACATTGGCAAAAAGTATGTTATTCTATTCTTCTACCCTTTGGACTTCACTTTTGTCTGCCCCACTGAGATTACTGCCTTCAGTGACCGTTATGAAGAATTTGAGAAGCTAAACACCGAAGTATTAGGGGTCTCTGTCGACAGTGTGTTCTCGCATCTTGCGTGGGTCCAAACAGACAGAAAGTCGGGAGGGCTCGGTGATCTGAATTATCCTCTTGTTTCGGATATCACTAAATCCATTTCAAAATCGTTTGGAGTGCTCATCCCTGATCAGGGCATTGCACTGAGAGGGCTTTTCATCATAGACAAGGAAGGAGTCATTCAGCATTCCACCATCAACAACCTCGGTATTGGCCGAAGTGTTGATGAGACAATGAGAACCCTCCAGGCATTACAGTATGTTCAAGAAAACCCGGATGAAGTGTGCCCTGCGGGATGGAAGCCAGGGGAGAAATCAATGAAACCTGACCCCAAGCTCAGCAAAGAATACTTTTCAGCTATCTAGAGGCTAAGATTGAACACATGTTTGGTGAAAATTAGCAATCAGAGTTGTTTTATTCGTCTTTTCAAAGTTGGAGCAGAGTTGTTATTTTTAGCCAAAGAACCTTTGTATCTATCTCATCTTTCTCCTGTTTCTGCTATGTGATTCTCCTTAAATTGAATCAAAAATAAAGAAATCCTTCTTTTCTTTTGCCAATATTTATGTCTTTCACTTGTGT
CDS Sequence
Protein Sequence