Gene Details:
- Gene ID: AT5G06320
- Gene Symbol: NHL3
- Gene Name: NDR1/HIN1-like 3
- Description: NDR1/HIN1-like 3;(source:Araport11)
- TAIR Accession: locus:2164305
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000013 — cauline leaf — hoja caulinar (Spanish, exact), 茎生葉、茎葉 (Japanese, exact)
- PO:0000014 — rosette leaf — hoja en roseta (Spanish, exact), ロゼット葉 (Japanese, exact)
- PO:0009001 — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Gene Ontology:
- GO:0005886 — located in — plasma membrane
- GO:0005794 — located in — Golgi apparatus
- GO:0009617 — acts upstream of or within — response to bacterium
- GO:0042742 — involved in — defense response to bacterium
- GO:0051607 — acts upstream of or within — defense response to virus
- GO:0009751 — involved in — response to salicylic acid
- GO:0042742 — acts upstream of or within — defense response to bacterium
- GO:0009506 — located in — plasmodesma
- GO:0005515 — enables — protein binding
- GO:0071456 — acts upstream of or within — cellular response to hypoxia
- GO:0005739 — located in — mitochondrion
- GO:0003729 — enables — mRNA binding
- GO:0000325 — located in — plant-type vacuole
- GO:0009611 — involved in — response to wounding
- GO:0009506 — is active in — plasmodesma
Function-related keywords:
- cauline leaf , rosette leaf , fruit , root , flower , stem , root , plant sperm cell
Literature:
- Transcriptome analysis of Arabidopsis colonized by a plant-growth promoting rhizobacterium reveals a general effect on disease resistance. DOI: 10.1046/j.1365-313x.2003.01867.x ; PMID: 14535883
- Up-regulation of Arabidopsis thaliana NHL10 in the hypersensitive response to Cucumber mosaic virus infection and in senescing leaves is controlled by signalling pathways that differ in salicylate involvement. DOI: 10.1007/s00425-003-1169-2 ; PMID: 14666423
- Plant body weight-induced secondary growth in Arabidopsis and its transcription phenotype revealed by whole-transcriptome profiling. DOI: 10.1104/pp.104.038844 ; PMID: 15194820
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- The potassium-dependent transcriptome of Arabidopsis reveals a prominent role of jasmonic acid in nutrient signaling. DOI: 10.1104/pp.104.046482 ; PMID: 15347784
- Cesium toxicity in Arabidopsis. DOI: 10.1104/pp.104.046672 ; PMID: 15489280
- A guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. DOI: 10.1016/j.cub.2005.05.048 ; PMID: 16005291
- The zinc-finger protein Zat12 plays a central role in reactive oxygen and abiotic stress signaling in Arabidopsis. DOI: 10.1104/pp.105.068254 ; PMID: 16183833
- Potato homologs of Arabidopsis thaliana genes functional in defense signaling–identification, genetic mapping, and molecular cloning. DOI: 10.1094/MPMI-18-1107 ; PMID: 16255250
- BnNHL18A shows a localization change by stress-inducing chemical treatments. DOI: 10.1016/j.bbrc.2005.10.210 ; PMID: 16298336
- Mapping the Arabidopsis organelle proteome. DOI: 10.1073/pnas.0506958103 ; PMID: 16618929
- The Arabidopsis thaliana transcriptome in response to Agrobacterium tumefaciens. DOI: 10.1094/MPMI-19-0665 ; PMID: 16776300
- Rapid transcriptome changes induced by cytosolic Ca2+ transients reveal ABRE-related sequences as Ca2+-responsive cis elements in Arabidopsis. DOI: 10.1105/tpc.106.042713 ; PMID: 16980540
- Integration of Arabidopsis thaliana stress-related transcript profiles, promoter structures, and cell-specific expression. DOI: 10.1186/gb-2007-8-4-r49 ; PMID: 17408486
- Core genome responses involved in acclimation to high temperature. DOI: 10.1104/pp.107.112060 ; PMID: 18055584
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Iron-dependent modifications of the flower transcriptome, proteome, metabolome, and hormonal content in an Arabidopsis ferritin mutant. DOI: 10.1093/jxb/ert112 ; PMID: 23682113
- AtOZF1 Positively Regulates Defense Against Bacterial Pathogens and NPR1-Independent Salicylic Acid Signaling. DOI: 10.1094/MPMI-08-17-0208-R ; PMID: 29327969
- Integrative Analysis from the Epigenome to Translatome Uncovers Patterns of Dominant Nuclear Regulation during Transient Stress. DOI: 10.1105/tpc.19.00463 ; PMID: 31519798
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- A PDLP-NHL3 complex integrates plasmodesmal immune signaling cascades. DOI: 10.1073/pnas.2216397120 ; PMID: 37068237
- Up-regulation of Arabidopsis thaliana NHL10 in the hypersensitive response to Cucumber mosaic virus infection and in senescing leaves is controlled by signalling pathways that differ in salicylate involvement. DOI: 10.1007/s00425-003-1169-2 ; PMID: 14666423
- Mapping the Arabidopsis organelle proteome. DOI: 10.1073/pnas.0506958103 ; PMID: 16618929
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
Sequence:
cDNA Sequence
- >AT5G06320.1 TTTCAAAATCTTATCACAAACCAAAAAAAACTTTCTTTCAAAATCGTTCTCTGAGGCATTTTAACGAACAGATGGCGGACTTAAACGGTGCGTATTACGGACCATCGATTCCACCGCCGAAGAAAGTCTCTCACAGCCACGGCAGACGCGGCGGTGGATGCGGTTGTTTAGGTGACTGTCTTGGCTGCTGCGGCTGCTGTATCTTAAGCGTCATCTTCAACATCCTCATAACCATAGCCGTCTTATTAGGCATAGCTGCTCTAATCATCTGGCTCATTTTCAGACCCAACGCTATCAAATTCCACGTCACCGACGCTAAACTCACCGAATTCACACTCGACCCAACCAACAACCTCCGATACAATCTCGATCTCAATTTCACAATCCGTAACCCTAACCGCCGGATCGGTGTTTACTATGATGAAATCGAAGTCAGAGGATACTACGGTGATCAGCGATTCGGTATGAGTAACAACATCTCGAAGTTTTACCAGGGACATAAGAACACGACGGTGGTTGGAACTAAACTCGTGGGACAGCAATTGGTGCTGCTTGACGGCGGAGAGAGGAAGGATTTGAACGAGGATGTGAATTCTCAGATCTATAGGATCGATGCCAAGCTGAGACTTAAGATTAGGTTTAAGTTTGGGTTGATCAAGTCGTGGAGGTTCAAGCCCAAGATCAAGTGCGATCTCAAGGTTCCTCTTACCTCTAATTCAACCAGCGGGTTTGTTTTTCAGCCGACCAAGTGTGACGTTGACTTTTGATTGCTAGTCAAGAGTCAATGCTATTATAGTCTTCTTCGAGTTCATCATATTACACTTGTTTATTGATTCTTATTTTAGATTGTTTTGCTTTATTATCTTCCATACATATCGTTGGAGAGAGATATTTTTCTTATGTAATGTTTTATTGTATGGTTCCATGTAAATAAATAATCACATTTTGTTTAATGCTAATAACTATACAATTAGCATTATGATTGTCTCA
CDS Sequence
Protein Sequence