Gene Details:
- Gene ID: AT5G06870
- Gene Symbol: ATPGIP2, PGIP2
- Gene Name: ARABIDOPSIS POLYGALACTURONASE INHIBITING PROTEIN 2, polygalacturonase inhibiting protein 2
- Description: polygalacturonase inhibiting protein 2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Function-related keywords:
Literature:
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- Classification of genes differentially expressed during water-deficit stress in Arabidopsis thaliana: an analysis using microarray and differential expression data. DOI: 10.1093/aob/mcf104 ; PMID: 12102506
- Tandemly duplicated Arabidopsis genes that encode polygalacturonase-inhibiting proteins are regulated coordinately by different signal transduction pathways in response to fungal infection. DOI: 10.1105/tpc.005165 ; PMID: 12509524
- The leucine-rich repeat as a protein recognition motif. DOI: 10.1016/s0959-440x(01)00266-4 ; PMID: 11751054
- Systemic gene expression in Arabidopsis during an incompatible interaction with Alternaria brassicicola. DOI: 10.1104/pp.103.021683 ; PMID: 12805628
- Proteomic analysis of changes in the extracellular matrix of Arabidopsis cell suspension cultures induced by fungal elicitors. DOI: 10.1002/pmic.200300413 ; PMID: 12833529
- Proteomics of loosely bound cell wall proteins of Arabidopsis thaliana cell suspension cultures: a critical analysis. DOI: 10.1002/elps.200305608 ; PMID: 14595688
- B1-phytoprostanes trigger plant defense and detoxification responses. DOI: 10.1104/pp.104.051714 ; PMID: 15618427
- Co-immunoprecipitation of Hsp101 with cytosolic Hsc70. DOI: 10.1016/j.plaphy.2004.10.006 ; PMID: 15763661
- Cell wall proteins in apoplastic fluids of Arabidopsis thaliana rosettes: identification by mass spectrometry and bioinformatics. DOI: 10.1002/pmic.200400882 ; PMID: 15593128
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Gene expression programs during shoot, root, and callus development in Arabidopsis tissue culture. DOI: 10.1104/pp.106.081240 ; PMID: 16648215
- An integrated view of gene expression and solute profiles of Arabidopsis tumors: a genome-wide approach. DOI: 10.1105/tpc.106.044743 ; PMID: 17172353
- Developmental steps in acquiring competence for shoot development in Arabidopsis tissue culture. DOI: 10.1007/s00425-007-0565-4 ; PMID: 17581762
- Genotypic variation in genome-wide transcription profiles induced by insect feeding: Brassica oleracea–Pieris rapae interactions. DOI: 10.1186/1471-2164-8-239 ; PMID: 17640338
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- A peroxidase-dependent apoplastic oxidative burst in cultured Arabidopsis cells functions in MAMP-elicited defense. DOI: 10.1104/pp.111.190140 ; PMID: 22319074
- and low pH-tolerance that are regulated by STOP1 in Arabidopsis. DOI: 10.1093/mp/sst116 ; PMID: 23935008
- COI1-dependent jasmonate signalling affects growth, metabolite production and cell wall protein composition in arabidopsis. DOI: 10.1093/aob/mcy109 ; PMID: 29924303
- Mitochondrial function modulates touch signalling in Arabidopsis thaliana. DOI: 10.1111/tpj.14183 ; PMID: 30537160
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- The leucine-rich repeat as a protein recognition motif. DOI: 10.1016/s0959-440x(01)00266-4 ; PMID: 11751054
- Proteomics of loosely bound cell wall proteins of Arabidopsis thaliana cell suspension cultures: a critical analysis. DOI: 10.1002/elps.200305608 ; PMID: 14595688
- Cell wall proteins in apoplastic fluids of Arabidopsis thaliana rosettes: identification by mass spectrometry and bioinformatics. DOI: 10.1002/pmic.200400882 ; PMID: 15593128
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
- A sub-proteome of Arabidopsis thaliana mature stems trapped on Concanavalin A is enriched in cell wall glycoside hydrolases. DOI: 10.1093/jxb/erm082 ; PMID: 17526915
- Analysis of the Arabidopsis cytosolic proteome highlights subcellular partitioning of central plant metabolism. DOI: 10.1021/pr1009433 ; PMID: 21166475
Sequence:
cDNA Sequence
- >AT5G06870.1 AAAACACAAACACCAAAAACACTATGGATAAGACAATGACACTGTTCTTGCTCTTGTCCACTCTCCTCCTCACGACTTCTTTAGCTAAAGATCTCTGTCATAAAGATGACAAAACTACCCTCCTCAAGATCAAGAAATCCCTAAACAACCCTTACCACCTCGCCTCATGGGATCCCAAAACCGACTGTTGCTCTTGGTACTGCCTCGAGTGCGGCGACGCTACTGTCAACCACCGTGTCACTTCCCTAATCATACAAGACGGCGAGATCTCCGGTCAGATCCCCCCTGAAGTCGGTGACTTACCGTATCTTACATCCCTTATCTTCCGCAAACTCACTAACCTCACTGGTCACATCCAACCCACTATCGCCAAGCTCAAGAACCTCACTTTTCTCAGACTAAGCTGGACCAATCTCACCGGTCCGGTTCCTGAGTTTCTGAGTCAGCTCAAGAATCTTGAGTACATTGACCTTTCCTTCAATGACCTCTCTGGTTCCATACCTAGTTCCCTCTCTTCATTACGTAAACTCGAGTATCTTGAACTTAGTAGGAACAAGCTTACAGGTCCGATACCAGAGTCATTTGGGACGTTTTCAGGAAAGGTCCCTAGTCTTTTCCTATCACACAACCAGCTCTCTGGTACTATACCAAAGTCACTAGGCAATCCCGACTTTTACCGCATCGATTTATCTCGGAACAAGCTTCAAGGCGATGCTTCAATCTTGTTTGGAGCTAAAAAAACAACATGGATCGTTGATATATCAAGAAACATGTTCCAGTTCGATCTCTCCAAGGTTAAGCTCGCTAAGACACTTAATAACTTGGACATGAATCACAATGGCATCACAGGGAGTATTCCGGCTGAGTGGAGCAAAGCTTATTTTCAGTTACTGAATGTTAGCTATAACAGACTGTGTGGACGCATCCCCAAAGGAGAGTATATTCAAAGATTTGATTCTTATTCCTTTTTCCACAACAAGTGTTTATGTGGTGCACCTCTTCCTAGTTGCAAGTGAAGATTCCAGCAAAACCAAGCATTATCTCTGATATACCAAATAATTAATCAAGTCTAGTGACAATTGTGTTTTTATTTTGAATGATTAATAAAAGCATGAACCAATGTTTTAGCTTGATTTCATTGATTAACGGAAAAAGTTGAACAAAAAAA
CDS Sequence
Protein Sequence