Gene Details:
- Gene ID: AT5G07230
- Gene Symbol: A9
- Gene Name:
- Description: Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Literature:
- Chromatin and siRNA pathways cooperate to maintain DNA methylation of small transposable elements in Arabidopsis. DOI: 10.1186/gb-2005-6-11-r90 ; PMID: 1627774
- Genome-wide analysis of spatial gene expression in Arabidopsis flowers. DOI: 10.1105/tpc.021741 ; PMID: 15100403
- The eight-cysteine motif, a versatile structure in plant proteins. DOI: 10.1016/j.plaphy.2004.03.009 ; PMID: 15191737
- Regulation of Arabidopsis tapetum development and function by DYSFUNCTIONAL TAPETUM1 (DYT1) encoding a putative bHLH transcription factor. DOI: 10.1242/dev.02463 ; PMID: 16831835
- ROXY1 and ROXY2, two Arabidopsis glutaredoxin genes, are required for anther development. DOI: 10.1111/j.1365-313X.2007.03375.x ; PMID: 18036205
- Genome-wide analysis of the rice and Arabidopsis non-specific lipid transfer protein (nsLtp) gene families and identification of wheat nsLtp genes by EST data mining. DOI: 10.1186/1471-2164-9-86 ; PMID: 18291034
- An extensive (co-)expression analysis tool for the cytochrome P450 superfamily in Arabidopsis thaliana. DOI: 10.1186/1471-2229-8-47 ; PMID: 18433503
- Acyl-lipid metabolism. DOI: 10.1199/tab.0161 ; PMID: 23505340
- Abundant type III lipid transfer proteins in Arabidopsis tapetum are secreted to the locule and become a constituent of the pollen exine. DOI: 10.1104/pp.113.225706 ; PMID: 24096413
- AP1/2β-mediated exocytosis of tapetum-specific transporters is required for pollen development in Arabidopsis thaliana. DOI: 10.1093/plcell/koac192 ; PMID: 35766888
Sequence:
cDNA Sequence
- >AT5G07230.1 ATGGAATTCACCAATCCAAAAGTGAATAAAAAACAGAAGTACAAACAATATAGTATCTAATTAGAATGGTATCTCTAAAGTCCCTTGCTGCTATTCTCGTTGCCATGTTTCTTGCCACCGGACCTACGGTTCTAGCCCAGCAGTGCAGAGACGAACTGAGCAATGTGCAGGTGTGCGCGCCGCTGCTTCTGCCCGGTGCGGTCAATCCTGCCGCGAACTCAAATTGCTGCGCTGCCCTCCAAGCAACTAACAAAGATTGTCTATGTAACGCTCTTCGAGCAGCCACCACACTTACCTCTCTTTGTAACCTCCCCTCTTTTGATTGTGGCATAAGTGCCTAGTTGAACAACATTCAGTTCCGAGGATTTGGGGAGTTTGGTCTGCAAACGACAAGACGAATAAAATAAAATAATGAGAAATACACTATTTAGTGTTTTGTTTTGAATTTGGTTTGTTCAATACTTATGACAGATCTATTGAATATCGTTTTCACCATTATTACGGAATATTTTCTATAATTGGCATCATTGTAGTCTTGCTTTT
CDS Sequence
Protein Sequence