Gene Details:
- Gene ID: AT5G08050
- Gene Symbol: RIQ1
- Gene Name:
- Description: wiskott-aldrich syndrome family protein, putative (DUF1118);(source:Araport11)
- TAIR Accession: locus:2142848
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0009579 — located in — thylakoid
- GO:0009507 — located in — chloroplast
- GO:0003674 — enables — molecular_function
- GO:0009534 — located in — chloroplast thylakoid
- GO:0010196 — acts upstream of or within — nonphotochemical quenching
- GO:0009535 — located in — chloroplast thylakoid membrane
- GO:0045893 — acts upstream of or within — positive regulation of DNA-templated transcription
- GO:0009515 — located in — granal stacked thylakoid
- GO:0009658 — acts upstream of or within — chloroplast organization
- GO:0090391 — acts upstream of or within — granum assembly
- GO:0010027 — acts upstream of or within — thylakoid membrane organization
- GO:0005886 — located in — plasma membrane
Germplasm Phenotype:
- SALK_048774 — Reduced NPQ, affected organization of light-harvesting complex II and an enhanced grana stacking.
Literature:
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. DOI: 10.1074/jbc.M406763200 ; PMID: 15322131
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Karrikins enhance light responses during germination and seedling development in Arabidopsis thaliana. DOI: 10.1073/pnas.0911635107 ; PMID: 20351290
- Plastids are major regulators of light signaling in Arabidopsis. DOI: 10.1104/pp.112.193599 ; PMID: 22383539
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Grana-Localized Proteins, RIQ1 and RIQ2, Affect the Organization of Light-Harvesting Complex II and Grana Stacking in Arabidopsis. DOI: 10.1105/tpc.16.00296 ; PMID: 27600538
- Comparative proteomics of thylakoids from Arabidopsis grown in laboratory and field conditions. DOI: 10.1002/pld3.355 ; PMID: 34712896
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. DOI: 10.1074/jbc.M406763200 ; PMID: 15322131
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
Sequence:
cDNA Sequence
- >AT5G08050.1 CTTTACTAATATACTAATAACCGGTAAAAAGTGATGTGATTTGGATTGATTTCAACCGGAGAAGAGTTAACCACTCGCCGAACGACACGTGTTCAACACAATCCTATTCCTCCTAGCAATCTCAAAGCTTGTGTGATCTACAAGCTCTTGGTTTCTCCATTGAAGAAAAAGCTTTGACAAAACCAGGGAAAGAGACAGAGAGAGATAATGGCGGCTAAACTAATCTGTTCGTCTTTAACAGTGCATTCAATGGCAAATAAGAAGCCATCACCTTCTGCTGCAACAAGAACAATAACCTCAAAGAAGAGCACAGCGACTCCACAGGTGAAACTGCTGACAAGAGTCGAGCAGCTCAAGCTTCTGACCAAAGCCGAGAAAGCAGGACTTTTGTCTTTAGCAGAGAAATCAGGTTTCTCTCTATCGACCATCGAGCGTCTTGGATTGCTGACCAAAGCAGAGGAGTTCGGCGTTTTGTCTGCCGCCACAAACCCGGAAACGCCTGGAACGTTATTCACTTTGAGCCTCGGTTTACTCCTTCTTGGACCGGTTTTTGCATATGTGGTTCCTGAAGATTACACTTGGGAAGTAGTGATTCAGGTTCTTGTGGCTCTACTCTCTGTTCTTGGTGGCTCTGCTGCTTTTGCTGCTTCTGGTTTTGTCTCCAATTTGCAGAAATCTGATTAGCCCGATCGTTTTTTTTTTGTATCAAATATATTTACCCGGTGTAGCAAGAGACTTTTCTGCATTTAAGATGAAAACTTTATAATGTATTTGATCTACATTGTATCAACCAGTCATTTTCACTATTTTCTATCTATGTAAATGGTTTCATATACAGAATCCAAGAGAAACGTTTTGAATTTCAATACGTTTACTTATTGTTTTTGTTATGTGCAACAAGAAGAAGTTGTCTGTCACAACAGAA
CDS Sequence
Protein Sequence