Gene Details:
- Gene ID: AT5G09500
- Gene Symbol: uS19y
- Gene Name: Ribosomal Protein uS19y
- Description: Ribosomal protein S19 family protein;(source:Araport11)
- TAIR Accession: locus:2184752
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0000028 — involved in — ribosomal small subunit assembly
- GO:0003735 — enables — structural constituent of ribosome
- GO:0006412 — involved in — translation
- GO:0022627 — located in — cytosolic small ribosomal subunit
- GO:0005737 — located in — cytoplasm
- GO:0022627 — part of — cytosolic small ribosomal subunit
- GO:0003723 — enables — RNA binding
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- DNA array analyses of Arabidopsis thaliana lacking a vacuolar Na+/H+ antiporter: impact of AtNHX1 on gene expression. DOI: 10.1111/j.1365-313X.2004.02253.x ; PMID: 15546358
- Analysis of the female gametophyte transcriptome of Arabidopsis by comparative expression profiling. DOI: 10.1104/pp.105.067314 ; PMID: 16299181
- Pollen development and fertilization in Arabidopsis is dependent on the MALE GAMETOGENESIS IMPAIRED ANTHERS gene encoding a type V P-type ATPase. DOI: 10.1101/gad.357305 ; PMID: 16291648
- The Arabidopsis thaliana transcriptome in response to Agrobacterium tumefaciens. DOI: 10.1094/MPMI-19-0665 ; PMID: 16776300
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- A zinc knuckle protein that negatively controls morning-specific growth in Arabidopsis thaliana. DOI: 10.1073/pnas.0807264105 ; PMID: 18971337
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
Sequence:
cDNA Sequence
- >AT5G09500.1 GTCGTTTGCGCAGTCACTGTTTGAGGCTCTGTGGTGTTTTTTAGGTTTTCAGCAATTCCAAACAAACAATGGCGGATCCAGAGGTTGCTGCGGCTGGAATCGTAAAAAAGAGAACGTTCAAAAAGTTTTCCTTCAGAGGAGTCGATCTTGATGCTCTTCTCGACATGTCTACTGATGATCTTGTCAAGCTTTTCCCTTCCCGTATCCGTAGAAGGTTCTCTAGAGGATTGACGAGGAAGCCTATGGCTTTGATCAAGAAACTGCGGAAAGCGAAAATTGAAGCACCAGCTGGAGAGAAGCCAGCAGCAGTGAGAACCCACCTAAGGAACATGATCATTGTGCCTGAAATGATTGGAAGCGTCATCGGTGTTTACAATGGAAAGACTTTTAACCAGGTCGAGATCAAACCAGAGATGATTGGACATTACTTGGCTGAGTTTTCAATCTCATATAAGCCTGTTAAGCATGGTAGGCCTGGTGTTGGTGCTACCAATTCCTCCAGATTTATCCCTCTCAAGTGAATAATCAAGCTCTTGTGGAGTTTTGTTATGCTCTAAATTCGAGTCTTTCGTTTCTTTTTCTTTTAGAACATTTTGTCTTTCTTTTTCTCTTCTCTCCTTTAGATTTTGTTCAAACTCTTGTTCATGCCTTCAAATAATACAGAGCTTTTTATTTATAATC
CDS Sequence
Protein Sequence