Gene Details:

  • Gene ID: AT5G09810
  • Gene Symbol: ACT7, AtACT7
  • Gene Name: actin 7
  • Description: actin 7;(source:Araport11)
  • TAIR Accession: locus:2178128
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Plant Ontology Annotations:

  • PO:0000282  — trichome — tricoma (Spanish, exact), 毛茸、糸状体、毛 (Japanese, exact), seta (related), setae (related), capilli (narrow), capillus (narrow), cilia (narrow), cilium (narrow), glochid (narrow), glochidia (narrow), glochidium (narrow), hair (narrow), lepides (narrow), lepis (narrow), non-secretory trichome (narrow), scale (narrow), squama (narrow), squamae (narrow), squamella (narrow), squamellae (narrow), squamule (narrow), barb trichome (broad), bristle (broad)
  • PO:0009005  — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
  • PO:0000084  — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
  • PO:0000293  — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)

Gene Ontology:

  • GO:0048767  — acts upstream of or within — root hair elongation
  • GO:0048364  — acts upstream of or within — root development
  • GO:0009733  — acts upstream of or within — response to auxin
  • GO:0009506  — located in — plasmodesma
  • GO:0009941  — located in — chloroplast envelope
  • GO:0008104  — involved in — protein localization
  • GO:0005829  — located in — cytosol
  • GO:0009416  — acts upstream of or within — response to light stimulus
  • GO:0009570  — located in — chloroplast stroma
  • GO:0005737  — located in — cytoplasm
  • GO:0009611  — acts upstream of or within — response to wounding
  • GO:0005730  — located in — nucleolus
  • GO:0006893  — involved in — Golgi to plasma membrane transport
  • GO:0009505  — located in — plant-type cell wall
  • GO:0007010  — acts upstream of or within — cytoskeleton organization
  • GO:0051301  — acts upstream of or within — cell division
  • GO:0010053  — acts upstream of or within — root epidermal cell differentiation
  • GO:0005515  — enables — protein binding
  • GO:0005856  — located in — cytoskeleton
  • GO:0009845  — acts upstream of or within — seed germination
  • GO:0005200  — enables — structural constituent of cytoskeleton
  • GO:0005886  — located in — plasma membrane
  • GO:0005739  — located in — mitochondrion

Germplasm Phenotype:

  • act2-1/act7-4  — Plants are dwarf and reach only 15% of the height of wild type. Roots lack root hairs- the initiate but do not develop further than a bulge. Leaves are small with reduced surface area and fewer lobes. Leaf trichomes are abnormal and contain fewer branches. Also defects in flower morphology, reduced fertility, abnormal inflorescence structure and abnormal silique development.
  • act7  — Slow to produce callus in response to hormones
  • act7-4  — Abnormal roots. Roots are shorted and have fewer root hairs (ca. 20% less than wild type). Root epidermal cells have abnormal morphology and bulge.
  • act8-2/act7-4  — Plants are dwarf. Leaves are smaller and contain fewer cells and fewer lobes than wild type. Reduced number of trichome branches. Petals are narrow. Roots are more severely affected and produce short root hairs. Cell files are irregular and the elongation zone is much reduced.
  • unp1  — Aberrant nuclei position in dark-adapted and blue light-induced leaves. Reduced number of actin filaments, decrease in velocity of cytoplasmic streaming. Upwardly bent leaf petioles, reduced plant height, seed number per fruit, and fruit length. Sherical nuclei of pavement cells.

Literature:

Sequence:

cDNA Sequence
  • >AT5G09810.1 CCCAGATTTTTTATTTGGGAAATAATAGAAGAAATAGAAAAAAATAAAAGAGTGAGAAAAATCGTAGAGCTATATATTCGCACATGTACTCGTTTCGCTTTCCTTAGTGTTAGCTGCTGCCGCTGTTGTTTCTCCTCCATTTCTCTATCTTTCTCTCTCGCTGCTTCTCGAATCTTCTGTATCATCTTCTTCTTCTTCAAGTGAAAAATGGCCGATGGTGAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGTTTTGCTGGTGATGATGCCCCGAGAGCAGTGTTCCCAAGTATTGTTGGTCGTCCTAGGCACACTGGTGTCATGGTTGGTATGGGTCAGAAAGATGCTTACGTTGGTGATGAAGCTCAGTCCAAGAGAGGTATCCTCACTCTGAAGTATCCAATCGAACATGGTATTGTAAGTAACTGGGATGACATGGAAAAGATATGGCATCACACTTTCTACAACGAGCTTCGTGTTGCCCCTGAGGAGCACCCAGTTCTACTCACAGAGGCACCTCTTAACCCTAAAGCTAACAGGGAGAAGATGACTCAGATCATGTTTGAGACATTCAATGTCCCTGCCATGTATGTTGCCATTCAGGCCGTTCTTTCTCTCTATGCCAGTGGTCGTACAACCGGTATTGTGCTCGATTCTGGTGATGGTGTGTCTCACACTGTGCCAATCTACGAGGGGTATGCTCTTCCTCATGCTATCCTTCGTCTTGATCTTGCGGGTCGGGATCTCACAGACTCACTCATGAAGATTCTCACTGAGAGAGGTTACATGTTCACCACTACCGCAGAACGGGAAATTGTCCGTGACATAAAGGAGAAACTTGCTTATGTCGCTCTTGACTACGAGCAAGAGCTAGAGACAGCCAAGAGCAGTTCTTCAGTGGAGAAGAACTACGAGCTACCTGATGGACAAGTCATAACCATCGGAGCTGAGAGATTCCGTTGTCCTGAGGTTCTGTTCCAGCCATCGCTCATCGGAATGGAAGCTCCTGGAATCCATGAAACAACTTACAACTCCATCATGAAATGTGATGTCGATATCAGGAAGGATCTCTATGGAAACATCGTTCTCAGTGGTGGTTCCACCATGTTCCCAGGAATTGCTGACCGTATGAGCAAAGAGATCACCGCTCTTGCACCTAGCAGCATGAAGATCAAGGTGGTTGCACCGCCAGAGAGAAAATACAGTGTCTGGATCGGAGGATCAATCCTTGCATCCCTCAGCACCTTCCAACAGATGTGGATTTCAAAGAGTGAGTACGATGAGTCAGGTCCATCGATTGTTCACAGGAAATGCTTCTAAGTGTGTCTTGTCTTATCTGGTTCGTGGTGGTGAGTTTGTTACAAAAAAATCTATTTTCCCTAGTTGAGATGGGAATTGAACTATCTGTTGTTATGTGGATTTTATTTTCTTTTTTCTCTTTAGAACCTTATGGTTGTGTCAAGAAGTCTTGTGTACTTTAGTTTTATATCTCTGTTTTATCTCTTCTATTTTCTTTAGGATGCTTGTGATGATGCTGTTTTTTTTTGTCCCTAAGCAAAAAAATATCATATTATATTTGGTCCTTGGTTCATTTTTTTGGTTTTTTTTTGTCTTCACATATAAATATTGTTTGAATGTCTTCAATCTTTTATTTGTATGAGACAATTATTTAAGTATCGGGTGACAATGCAGCTATTATGTATTGTCGATTGTTATATTGGCGCCCAAAATATATACTTAGCCTAAGAATTTGGTAAGTGAGTGGCTTATGTTTTACTCCAGCAAAAATTG
CDS Sequence
Protein Sequence