Gene Details:
- Gene ID: AT5G10430
- Gene Symbol: AGP4, ATAGP4, JAGGER
- Gene Name: arabinogalactan protein 4
- Description: arabinogalactan protein 4;(source:Araport11)
- TAIR Accession: locus:2142524
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0010198 — acts upstream of or within — synergid death
- GO:0016020 — located in — membrane
- GO:0005886 — located in — plasma membrane
Function-related keywords:
Literature:
- Glycosylphosphatidylinositol-anchored cell-surface proteins from Arabidopsis. DOI: 10.1002/(SICI)1522-2683(19990701)20:10<2027::AID-ELPS2027>3.0.CO;2-A ; PMID: 10451111
- Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis. DOI: 10.1104/pp.010884 ; PMID: 12068095
- Using genomic resources to guide research directions. The arabinogalactan protein gene family as a test case. DOI: 10.1104/pp.003459 ; PMID: 12177459
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- The fasciclin-like arabinogalactan proteins of Arabidopsis. A multigene family of putative cell adhesion molecules. DOI: 10.1104/pp.103.031237 ; PMID: 14645732
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- The potassium-dependent transcriptome of Arabidopsis reveals a prominent role of jasmonic acid in nutrient signaling. DOI: 10.1104/pp.104.046482 ; PMID: 15347784
- Detoxification and transcriptome response in Arabidopsis seedlings exposed to the allelochemical benzoxazolin-2(3H)-one. DOI: 10.1074/jbc.M500694200 ; PMID: 15824099
- Genome-wide identification of genes expressed in Arabidopsis pistils specifically along the path of pollen tube growth. DOI: 10.1104/pp.105.060558 ; PMID: 15894741
- CINNAMYL ALCOHOL DEHYDROGENASE-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. DOI: 10.1105/tpc.105.030767 ; PMID: 15937231
- AtFLA11, a fasciclin-like arabinogalactan-protein, specifically localized in sclerenchyma cells. DOI: 10.1271/bbb.69.1963 ; PMID: 16244449
- Expression of arabinogalactan protein genes in pollen tubes of Arabidopsis thaliana. DOI: 10.1007/s00425-005-0137-4 ; PMID: 16228244
- Synteny conservation between the Prunus genome and both the present and ancestral Arabidopsis genomes. DOI: 10.1186/1471-2164-7-81 ; PMID: 16615871
- and jasmonic acid/ethylene-dependent responses via EDS1 and PAD4. DOI: 10.1111/j.1365-313X.2006.02806.x ; PMID: 16813576
- Characterization of the VIER F-BOX PROTEINE genes from Arabidopsis reveals their importance for plant growth and development. DOI: 10.1105/tpc.105.040675 ; PMID: 17435085
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Phenotypic screening of Arabidopsis T-DNA insertion lines for cell wall mechanical properties revealed ANTHOCYANINLESS2, a cell wall-related gene. DOI: 10.1016/j.jplph.2015.11.011 ; PMID: 26720211
- The classical arabinogalactan protein gene family of arabidopsis. DOI: 10.1105/tpc.12.9.1751 ; PMID: 11006345
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
Sequence:
cDNA Sequence
- >AT5G10430.1 GTTACAATTATGCGTTTGCATGTTAGTCTGCAAAATTTATCTTTAATATATTAAAAGAGATTTATAGGAATCTTGTTTTAATTTAATCGAAATAATTCTTCACATTTTTCCTCCTTTTTATACATCTCTTCCATTTTTCCTCACCTTCACAACTCTCTCATAATCTCTCTCCCTCACTCTAACACCAAAAGAAGAAGAAGCATTTTCCAAAGAGAAAGAGAGAGAAATGGGTTCCAAGATTGTCCAAGTTTTCTTGATGTTGGCTCTATTCGCCACTTCAGCACTCGCTCAAGCCCCTGCTCCTACTCCCACCGCCACTCCTCCTCCCGCAACTCCCCCTCCAGTCGCAACTCCTCCTCCAGTGGCTACCCCACCACCTGCTGCAACCCCTGCCCCAGCCACGCCACCACCTGCTGCAACCCCAGCTCCTGCCACTACTCCACCGTCAGTTGCTCCTTCTCCTGCTGATGTTCCCACCGCCTCTCCACCAGCACCGGAAGGTCCCACCGTGAGCCCAAGCAGTGCTCCCGGACCTTCAGATGCATCCCCTGCCCCAAGCGCCGCATTCTCCAACAAGGCTTTCTTCGCCGGAACCGCCTTCGCCGCTATTATGTACGCCGCCGTTTTGGCTTGAGAACTTTTTTTATATAATTTTTTTTTTATCCCTCAAATTATTTCAAATCTTTGGTGTTAATGTGAGAATTTGATTTATTTTCGTATTTCGCTATTTGATCGTTAATTTTTTTTATCATGATTTCGTGTGTCGGAATGGGGAAAGTAATTATTATCTTGGTTGAAGCTAATGGAATGTTGACACGTGTAATTTACCATTGGAAGGGCTTCATATGGTTGTGTAGAGGAGGTGGAATTAATCTGTTTATGTAAATCCAATGATAATAAATCAATTTCATTACTCTTTCACTTAAACATAATCCCACATGGTTTTGCTTTAACAACACACACTACAACAAGGC
CDS Sequence
Protein Sequence