Gene Details:
- Gene ID: AT5G10860
- Gene Symbol: CBSX3
- Gene Name: CBS domain containing protein 3
- Description: Cystathionine beta-synthase (CBS) family protein;(source:Araport11)
- TAIR Accession: locus:2183740
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0005739 — located in — mitochondrion
- GO:0005886 — located in — plasma membrane
- GO:0045454 — acts upstream of or within — cell redox homeostasis
- GO:0005829 — located in — cytosol
- GO:0050897 — enables — cobalt ion binding
Function-related keywords:
Literature:
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- Transcriptome analysis of Arabidopsis colonized by a plant-growth promoting rhizobacterium reveals a general effect on disease resistance. DOI: 10.1046/j.1365-313x.2003.01867.x ; PMID: 14535883
- Large-scale identification of leaf senescence-associated genes. DOI: 10.1046/j.1365-313x.2003.01908.x ; PMID: 14617064
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Versatile gene-specific sequence tags for Arabidopsis functional genomics: transcript profiling and reverse genetics applications. DOI: 10.1101/gr.2544504 ; PMID: 15489341
- Identification of plant glutaredoxin targets. DOI: 10.1089/ars.2005.7.919 ; PMID: 15998247
- XcisClique: analysis of regulatory bicliques. DOI: 10.1186/1471-2105-7-218 ; PMID: 16630346
- Exploiting the wild crucifer Thlaspi arvense to identify conserved and novel genes expressed during a plant's response to cold stress. DOI: 10.1007/s11103-006-9080-4 ; PMID: 16972165
- Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. DOI: 10.1104/pp.107.111286 ; PMID: 18218973
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Divalent metal ions in plant mitochondria and their role in interactions with proteins and oxidative stress-induced damage to respiratory function. DOI: 10.1104/pp.109.147942 ; PMID: 20018591
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- CBSXs are sensor relay proteins sensing adenosine-containing ligands in Arabidopsis. DOI: 10.4161/psb.19945 ; PMID: 22580706
- Structural and functional characteristics of cGMP-dependent methionine oxidation in Arabidopsis thaliana proteins. DOI: 10.1186/1478-811X-11-1 ; PMID: 23289948
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Comparative proteomic analysis of NaCl stress-responsive proteins in Arabidopsis roots. DOI: 10.1093/jxb/erm207 ; PMID: 17916636
- Heterogeneity of the mitochondrial proteome for photosynthetic and non-photosynthetic Arabidopsis metabolism. DOI: 10.1074/mcp.M700535-MCP200 ; PMID: 18385124
- Structural and functional characteristics of cGMP-dependent methionine oxidation in Arabidopsis thaliana proteins. DOI: 10.1186/1478-811X-11-1 ; PMID: 23289948
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequence:
cDNA Sequence
- >AT5G10860.1 GATGATTATCCATTAGAGAACCCTTCAAAAAACTCTCCACTCAACTCTCTCTGGTCAGCTGTCTCTTCCCCATTCTCTAGGGTTTTCAAGCTCAACCTCAAGCTCCACTACGATCTCTTCTTCTTCTCTAATCTCAGTTGAAAGATGCAAGGTGTGATTCGATCCTTCGTCTCCGGTGGAAATGTTGTGAAAGGCTCTGTGCTGCAACATCTCCGTGTGATTAACCCGGCGATTCAGCCTTCTGTGTTTTGTTCACGCTCTGAATCAACTCAACCTGCACGTATGGAGGAATCTGGATTCGAGAGCACAACTATTTCCGATGTCATGAAATCCAAAGGCAAAAGTGCTGATGGATCTTGGCTTTGGTGTACTACTGATGACACTGTTTATGATGCTGTTAAATCCATGACACAACACAATGTTGGTGCCTTGGTGGTTGTGAAACCTGGTGAGCAACAAGCTCTTGCTGGTATCATTACAGAGAGAGATTATCTACGGAAGATCATTGTGCAAGGGAGATCATCCAAATCAACAAAAGTTGGAGACATTATGACTGAAGAGAATAAGCTTATCACTGTGACACCGGAGACCAAGGTCTTGCGTGCTATGCAACTGATGACAGATAACCGAATCAGGCATATTCCGGTAATCAAAGACAAGGGCATGATTGGAATGGTGTCCATAGGAGATGTTGTCCGTGCAGTGGTTCATGAGCATAGAGAGGAGCTTCAACGCCTAAATGCGTATATTCAGGGAGGTTACTAGATCTTGAATAATGGAAAGAAAAGAGTTCCCTGTTGTGTCGTCTGGTCTTGTGCTGCTGAATCTGAAAAGCTTCCAGATCAGTGTAAATATGCAGTCCTCGTTGTTATTGTTGTTGTTGTTGTGTTTGATGTTTTGTGTTGTTTCGTTGTTTAACTTGTCAAAACTAAGGCCTTGTGCTGCTTCTCTTCTTGCGCTTACTTAGCAAGAGAATAAAACCAAAAACTCTGATCTCTTTATGAAAGATATGATGTTTGTTTTTGTTATCAAATCTTGCGTCAAGTATCCATGTGTGTTATGAAATAATAGAATTACTTTGAAAATTTGATTTCGG
CDS Sequence
Protein Sequence