Gene Details:
- Gene ID: AT5G12020
- Gene Symbol: HSP17.6II
- Gene Name: 17.6 kDa class II heat shock protein
- Description: 17.6 kDa class II heat shock protein;(source:Araport11)
- TAIR Accession: locus:2143109
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Gene Ontology:
- GO:0071456 — acts upstream of or within — cellular response to hypoxia
- GO:0005737 — located in — cytoplasm
- GO:0051259 — involved in — protein complex oligomerization
- GO:0042542 — involved in — response to hydrogen peroxide
- GO:0043621 — enables — protein self-association
- GO:0009408 — involved in — response to heat
- GO:0009651 — involved in — response to salt stress
- GO:0051082 — enables — unfolded protein binding
- GO:0006457 — involved in — protein folding
Function-related keywords:
Literature:
- Cell cycle-regulated gene expression in Arabidopsis. DOI: 10.1074/jbc.M207570200 ; PMID: 12169696
- Microarray expression analyses of Arabidopsis guard cells and isolation of a recessive abscisic acid hypersensitive protein phosphatase 2C mutant. DOI: 10.1105/tpc.019000 ; PMID: 14973164
- Harpin inactivates mitochondria in Arabidopsis suspension cells. DOI: 10.1094/MPMI.2004.17.2.131 ; PMID: 14964527
- When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress. DOI: 10.1104/pp.103.033431 ; PMID: 15047901
- Expression profiling reveals COI1 to be a key regulator of genes involved in and methyl jasmonate-induced secondary metabolism, defence, and hormone interactions. DOI: 10.1007/s11103-005-7306-5 ; PMID: 16021335
- Genomewide nonadditive gene regulation in Arabidopsis allotetraploids. DOI: 10.1534/genetics.105.047894 ; PMID: 16172500
- 12-oxo-phytodienoic acid triggers expression of a distinct set of genes and plays a role in wound-induced gene expression in Arabidopsis. DOI: 10.1104/pp.105.067058 ; PMID: 16258017
- Identification and characterization of a stress-inducible and a constitutive small heat-shock protein targeted to the matrix of plant peroxisomes. DOI: 10.1104/pp.105.073841 ; PMID: 16531488
- A heat-inducible transcription factor, HsfA2, is required for extension of acquired thermotolerance in Arabidopsis. DOI: 10.1104/pp.106.091322 ; PMID: 17085506
- A novel transcriptional cascade regulating expression of heat stress proteins during seed development of Arabidopsis. DOI: 10.1105/tpc.106.048165 ; PMID: 17220197
- The Arabidopsis E3 SUMO ligase SIZ1 regulates plant growth and drought responses. DOI: 10.1105/tpc.106.049981 ; PMID: 17905899
- Global transcript levels respond to small changes of the carbon status during progressive exhaustion of carbohydrates in Arabidopsis rosettes. DOI: 10.1104/pp.107.115592 ; PMID: 18305208
- Microarray expression profiling of Arabidopsis thaliana L. in response to allelochemicals identified in buckwheat. DOI: 10.1093/jxb/ern168 ; PMID: 18603616
- Transcriptional profiling of pea ABR17 mediated changes in gene expression in Arabidopsis thaliana. DOI: 10.1186/1471-2229-8-91 ; PMID: 18783601
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Activation of catalase activity by a peroxisome-localized small heat shock protein Hsp17.6CII. DOI: 10.1016/j.jgg.2017.03.009 ; PMID: 28869112
- MicroRNA160 Modulates Plant Development and Heat Shock Protein Gene Expression to Mediate Heat Tolerance in Arabidopsis. DOI: 10.3389/fpls.2018.00068 ; PMID: 29449855
- Integrative Analysis from the Epigenome to Translatome Uncovers Patterns of Dominant Nuclear Regulation during Transient Stress. DOI: 10.1105/tpc.19.00463 ; PMID: 31519798
Sequence:
cDNA Sequence
- >AT5G12020.1 CTCATATTTTATCAAACCTGAGTTACAGAGTTCACAAAAACCAGAACGACCAAGACGTTTCTCGAACAATACGGAAGAACTTCTAAAGACCGCGACAATCGCTCTCTCGACAATCCTCTAGAAATATCCATCTCCACTCCTATTTAAGTCCCCACATTTCTCACATCAAACTCATCAAAGAAAACAAAAAGCCAAGAATCAAAGAATCAGGAAAGCAAACACAACACAACTAACAATGGATTTAGGAAGGTTTCCAATAATCTCAATCCTCGAAGACATGCTTGAAGTCCCCGAAGACCACAACAACGAGAAGACCCGCAACAACCCTTCACGAGTTTACATGCGAGACGCTAAGGCAATGGCTGCTACACCTGCTGACGTCATCGAGCACCCTAACGCATATGCATTCGTCGTGGACATGCCTGGAATCAAAGGAGATGAGATCAAGGTTCAGGTCGAGAACGACAATGTGCTTGTGGTGAGTGGAGAGAGGCAGAGAGAGAACAAAGAAAACGAAGGTGTGAAGTATGTGAGGATGGAGAGAAGAATGGGTAAGTTCATGAGGAAGTTTCAGTTGCCTGAAAATGCAGATTTGGACAAGATCTCTGCTGTTTGTCATGACGGTGTGTTGAAGGTTACTGTTCAGAAACTTCCTCCTCCGGAACCAAAGAAACCAAAGACAATTCAAGTTCAAGTTGCTTGAGTTTGTTTTGTGATTGTGTGTTGGATTTATCTATTTTGTTTTGATTTATGGATTTGATGAATGTAATCGGAATGCGTGAGGGATATGGTGTTTTGTTCTAAGATGAAATAAAAGTTTGTTCTGTTTCTTTCATTCTCCTTTGGGATATTCAAATTAATGAAGTTGTTATAAGAATCTT
CDS Sequence
Protein Sequence