Gene Details:
- Gene ID: AT5G12235
- Gene Symbol: CLE22
- Gene Name: CLAVATA3/ESR-RELATED 22
- Description: CLAVATA3/ESR-RELATED 22;(source:Araport11)
- TAIR Accession: locus:504954845
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0033612 — enables — receptor serine/threonine kinase binding
- GO:0048364 — acts upstream of or within — root development
- GO:0005739 — located in — mitochondrion
- GO:0048046 — located in — apoplast
- GO:0010078 — acts upstream of or within — maintenance of root meristem identity
- GO:0010087 — acts upstream of or within — phloem or xylem histogenesis
- GO:0045168 — involved in — cell-cell signaling involved in cell fate commitment
Literature:
- A large family of genes that share homology with CLAVATA3. DOI: 10.1104/pp.126.3.939 ; PMID: 11457943
- The Arabidopsis CLV3-like (CLE) genes are expressed in diverse tissues and encode secreted proteins. DOI: 10.1023/a:1022038932376 ; PMID: 12602871
- Evidence for functional conservation, sufficiency, and proteolytic processing of the CLAVATA3 CLE domain. DOI: 10.1104/pp.105.072678 ; PMID: 16407446
- Gain-of-function phenotypes of many CLAVATA3/ESR genes, including four new family members, correlate with tandem variations in the conserved CLAVATA3/ESR domain. DOI: 10.1104/pp.105.075515 ; PMID: 16489133
- Comprehensive analysis of CLE polypeptide signaling gene expression and overexpression activity in Arabidopsis. DOI: 10.1104/pp.110.163683 ; PMID: 20884811
- Antagonistic peptide technology for functional dissection of CLV3/ESR genes in Arabidopsis. DOI: 10.1104/pp.112.211029 ; PMID: 23321419
Sequence:
cDNA Sequence
- >AT5G12235.1 GAAAGGGAGAGCAACAAACTTTTAGAGGAAGTCATAGGTTAAAAGCCCCATAGCTTTTTCTTCCATCACTTTCATTCCTCTCTTCTCATTCTTACAGACTTTGAGAGAGAATTTATTTAAGAGATCTTGATCAGATCTTTTATACTTGCAAAAATCGATTCTAAATATATAATCTATACCTTATAGAGAAACTCTTCATATCTTGAAGATTCCTAAGAGATGGGAAATTACTACTCTAGAAGAAAATCTAGGAAACACATCACTACAGTTGCCTTGATCATCCTTCTTCTTCTTTTGTTTCTGTTTCTTTACGCTAAAGCTTCATCGTCTTCTCCTAATATACATCATCACTCAACTCATGGAAGCTTGAAGAAATCTGGAAATTTGGATCCAAAGCTTCATGATCTTGACTCCAATGCTGCGTCATCAAGAGGATCAAAATATACTAATTATGAAGGTGGTGGTGAAGATGTTTTTGAAGATGGCAAGAGAAGGGTCTTCACAGGTCCTAATCCATTGCACAATAGATAAATTTTTGCTTTTACAAGTTTTTGTGAATTTTTGTCTGAATAAAACTCATTTGTGCAAACACAAAAAACATATTTATTT
CDS Sequence
Protein Sequence