Gene Details:
- Gene ID: AT5G12990
- Gene Symbol: CLE40
- Gene Name: CLAVATA3/ESR-RELATED 40
- Description: CLAVATA3/ESR-RELATED 40;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Germplasm Phenotype:
- cle40-1 — Increased root waving when grown on hard agar plates.
Literature:
- A large family of genes that share homology with CLAVATA3. DOI: 10.1104/pp.126.3.939 ; PMID: 11457943
- The Arabidopsis CLV3-like (CLE) genes are expressed in diverse tissues and encode secreted proteins. DOI: 10.1023/a:1022038932376 ; PMID: 12602871
- Loss of CLE40, a protein functionally equivalent to the stem cell restricting signal CLV3, enhances root waving in Arabidopsis. DOI: 10.1007/s00427-003-0329-5 ; PMID: 12743822
- The 14-amino acid CLV3, CLE19, and CLE40 peptides trigger consumption of the root meristem in Arabidopsis through a CLAVATA2-dependent pathway. DOI: 10.1105/tpc.105.034009 ; PMID: 16055633
- Gain-of-function phenotypes of many CLAVATA3/ESR genes, including four new family members, correlate with tandem variations in the conserved CLAVATA3/ESR domain. DOI: 10.1104/pp.105.075515 ; PMID: 16489133
- A signaling module controlling the stem cell niche in Arabidopsis root meristems. DOI: 10.1016/j.cub.2009.03.060 ; PMID: 19398337
- Is the Arabidopsis root niche protected by sequestration of the CLE40 signal by its putative receptor ACR4? DOI: 10.4161/psb.4.7.8970 ; PMID: 19820344
- CLE peptide signaling during plant development. DOI: 10.1007/s00709-009-0095-y ; PMID: 20016993
- A parasitism gene from a plant-parasitic nematode with function similar to CLAVATA3/ESR (CLE) of Arabidopsis thaliana. DOI: 10.1111/j.1364-3703.2005.00270.x ; PMID: 20565649
- CLE signaling systems during plant development and nematode infection. DOI: 10.1093/pcp/pcs136 ; PMID: 23045524
- Moderation of Arabidopsis root stemness by CLAVATA1 and ARABIDOPSIS CRINKLY4 receptor kinase complexes. DOI: 10.1016/j.cub.2013.01.045 ; PMID: 23394827
- The CLE40 and CRN/CLV2 signaling pathways antagonistically control root meristem growth in Arabidopsis. DOI: 10.1093/mp/ssu094 ; PMID: 25178283
- Evidence for intermolecular interactions between the intracellular domains of the arabidopsis receptor-like kinase ACR4, its homologs and the Wox5 transcription factor. DOI: 10.1371/journal.pone.0118861 ; PMID: 25756623
- and CLE40-mediated columella stem cell homeostasis in Arabidopsis. DOI: 10.1093/jxb/erv257 ; PMID: 26019259
- CLE Peptide Signaling and Crosstalk with Phytohormones and Environmental Stimuli. DOI: 10.3389/fpls.2015.01211 ; PMID: 26779239
- A Collection of Mutants for CLE-Peptide-Encoding Genes in Arabidopsis Generated by CRISPR/Cas9-Mediated Gene Targeting. DOI: 10.1093/pcp/pcx139 ; PMID: 29036337
- Truncated BAM receptors interfere the apical meristematic activity in a dominant negative manner when ectopically expressed in Arabidopsis. DOI: 10.1016/j.plantsci.2018.01.003 ; PMID: 29606214
- Redox-Mediated Endocytosis of a Receptor-Like Kinase during Distal Stem Cell Differentiation Depends on Its Tumor Necrosis Factor Receptor Domain. DOI: 10.1104/pp.19.00616 ; PMID: 31471454
- CLE40 Signaling Regulates Root Stem Cell Fate. DOI: 10.1104/pp.19.00914 ; PMID: 31806736
- Conserved and differentiated functions of CIK receptor kinases in modulating stem cell signaling in Arabidopsis. DOI: 10.1016/j.molp.2021.04.001 ; PMID: 33823234
- The Cell Fate Controlling CLE40 Peptide Requires CNGCs to Trigger Highly Localized Ca2+ Transients in Arabidopsis thaliana Root Meristems. DOI: 10.1093/pcp/pcab079 ; PMID: 34059877
- Control of Arabidopsis shoot stem cell homeostasis by two antagonistic CLE peptide signalling pathways. DOI: 10.7554/eLife.70934 ; PMID: 34643181
Sequence:
cDNA Sequence
- >AT5G12990.1 CAAAGAGGTTTTTGAAATGGCGGCGATGAAATACAAAGGAAGCGTTTTTATCATATTAGTCATCCTTCTTCTTTCGTCCTCACTACTTGCTCACTCTTCTTCTACAAAATCCTTCTTTTGGTTAGGAGAAACACAAGATACGAAAGCCATGAAAAAGGAGAAGAAGATTGATGGAGGAACAGCTAATGAAGTTGAAGAAAGACAAGTTCCAACTGGATCCGACCCTCTTCATCATAAACACATTCCTTTTACTCCATAG
CDS Sequence
Protein Sequence