Gene Details:
- Gene ID: AT5G13430
- Gene Symbol: RISP
- Gene Name: Rieske FeS protein
- Description: Ubiquinol-cytochrome C reductase iron-sulfur subunit;(source:Araport11)
- TAIR Accession: locus:2181670
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0005750 — part of — mitochondrial respiratory chain complex III
- GO:0031966 — located in — mitochondrial membrane
- GO:0008121 — enables — ubiquinol-cytochrome-c reductase activity
- GO:0006122 — involved in — mitochondrial electron transport, ubiquinol to cytochrome c
- GO:0016491 — enables — oxidoreductase activity
- GO:0005739 — located in — mitochondrion
- GO:0046872 — enables — metal ion binding
- GO:0009536 — located in — plastid
Function-related keywords:
Literature:
- Proteomic identification of divalent metal cation binding proteins in plant mitochondria. DOI: 10.1016/s0014-5793(03)00101-7 ; PMID: 12606038
- New insights into the respiratory chain of plant mitochondria. Supercomplexes and a unique composition of complex II. DOI: 10.1104/pp.103.024620 ; PMID: 12970493
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Differential expression of the Arabidopsis cytochrome c genes Cytc-1 and Cytc-2. and meristem-specific expression of the Cytc-1 gene. DOI: 10.1104/pp.105.065920 ; PMID: 16113211
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Resolving and identifying protein components of plant mitochondrial respiratory complexes using three dimensions of gel electrophoresis. DOI: 10.1021/pr700595p ; PMID: 18189341
- Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport. DOI: 10.1104/pp.107.111260 ; PMID: 18305213
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Evidence for interactions between the mitochondrial import apparatus and respiratory chain complexes via Tim21-like proteins in Arabidopsis. DOI: 10.3389/fpls.2014.00082 ; PMID: 24653731
- Plant-Specific Preprotein and Amino Acid Transporter Proteins Are Required for tRNA Import into Mitochondria. DOI: 10.1104/pp.16.01519 ; PMID: 27789739
- Arabidopsis DGD1 SUPPRESSOR1 Is a Subunit of the Mitochondrial Contact Site and Cristae Organizing System and Affects Mitochondrial Biogenesis. DOI: 10.1105/tpc.18.00885 ; PMID: 31118221
- Proteomic identification of divalent metal cation binding proteins in plant mitochondria. DOI: 10.1016/s0014-5793(03)00101-7 ; PMID: 12606038
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Resolving and identifying protein components of plant mitochondrial respiratory complexes using three dimensions of gel electrophoresis. DOI: 10.1021/pr700595p ; PMID: 18189341
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequence:
cDNA Sequence
- >AT5G13430.1 AATACGCAAAAACCAAAAAAAACAAAACAAATTGACCTTTTCTCAAAGACAATTTTTAAGGGACTTACTAGTAAGTAGTCTCTTATGTTTTGTTTTGCATCGGCCGTCCCAAACCTGAGGATTTCTCTGTTCAGCTAGAGCGAAACCCTAGATTCACATTTGAGCTGAGAGATGCTGCGTGTAGCAGGGAGGAGGCTTTTCTCTGTCTCGCAGAGATCTTCGACTGCGACCTCCTTCGTCGTCTCCCGTGACCATACCCTTTCCGATGGTGGCGGCGACTCCTCTTCAGCTCCCAGATCCCTCCCCTCTGCAGATCTCTCATCTTACCACCGTAGCCTTATCAGAGGCTTCTCTTCTCAAGTCCTTGCTCAAGGAAATGAGATAGGTTTTGGTTCAGAAGTCCCAGCCACAGTCGAAGCTGTCAAAACGCCTAACTCAAAGATTGTCTATGATGACCATAACCATGAGCGTTACCCACCTGGTGACCCTAGCAAGCGTGCATTCGCCTATTTTGTCTTGTCGGGTGGGAGGTTTGTTTATGCCTCTGTCCTCCGCCTGCTTGTTTTGAAGCTTATTGTGAGCATGTCTGCAAGTAAAGATGTCCTTGCCCTTGCATCCCTTGAGGTTGACCTAGGGAGCATAGAACCAGGAACTACCGTGACAGTCAAGTGGCGTGGAAAGCCCGTCTTCATCAGGCGAAGAACAGAAGATGACATCAAGCTGGCCAATAGTGTGGATGTTGGATCCCTGAGGGACCCACAAGAAGACTCGGTTAGGGTCAAGAATCCAGAATGGTTAGTGGTTGTTGGAGTGTGCACTCATTTGGGGTGCATCCCCTTGCCTAATGCTGGTGATTATGGTGGTTGGTTTTGTCCGTGTCACGGATCACATTACGATATATCTGGAAGAATTAGGAAAGGTCCTGCACCATACAACCTGGAAGTACCAACCTACAGCTTCCTGGAAGAGAATAAGTTACTCATCGGTTGATTAATAAAAGCACAACAGTCAAGAGTCTGGATCTGAATGATGATCTTCACTTGTTCTTTTTTTCTTTTAATTAATATTTTCCGGCATGTTAGAGCAAGATTGACTTGTTTTTGCTGAATAATACAAACTTGTGATTTTTGTTTGAAGTATACTCAATCTTCGTTTATCCATCGCTAGTAAAAGACGACTATGTTCATAGTCTGTGTTTATTATTTAACATGCCTATTTGTCCTATGTATGAGTGAGATTCCTTTCGTATCTCATAATTCTAAACATCGTCATTCCAATTAAAAAGTTGTATTTACATT
CDS Sequence
Protein Sequence