Gene Details:

  • Gene ID: AT5G13930
  • Gene Symbol: ATCHS, CHS, TT4
  • Gene Name: CHALCONE SYNTHASE, TRANSPARENT TESTA 4
  • Description: Chalcone and stilbene synthase family protein;(source:Araport11)
  • TAIR Accession: locus:2159098
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Plant Ontology Annotations:

  • PO:0000293  — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
  • PO:0025181  — root elongation zone — zona de elongación de la raíz (Spanish, exact), 根伸長帯(層) (Japanese, exact)

Gene Ontology:

  • GO:0009715  — acts upstream of or within — chalcone biosynthetic process
  • GO:0005515  — enables — protein binding
  • GO:0009753  — acts upstream of or within — response to jasmonic acid
  • GO:0009813  — involved in — flavonoid biosynthetic process
  • GO:0009813  — acts upstream of or within — flavonoid biosynthetic process
  • GO:0009926  — acts upstream of or within — auxin polar transport
  • GO:0030639  — involved in — polyketide biosynthetic process
  • GO:0005634  — located in — nucleus
  • GO:0016747  — enables — acyltransferase activity, transferring groups other than amino-acyl groups
  • GO:0031540  — acts upstream of or within — regulation of anthocyanin biosynthetic process
  • GO:0009705  — located in — plant-type vacuole membrane
  • GO:0005783  — located in — endoplasmic reticulum
  • GO:0009733  — acts upstream of or within — response to auxin
  • GO:0016210  — enables — naringenin-chalcone synthase activity
  • GO:0102128  — enables — chalcone synthase activity
  • GO:0009611  — acts upstream of or within — response to wounding
  • GO:0009629  — acts upstream of or within — response to gravity
  • GO:0010224  — acts upstream of or within — response to UV-B
  • GO:0006979  — acts upstream of or within — response to oxidative stress
  • GO:0005737  — located in — cytoplasm

Germplasm Phenotype:

  • CS2105572  — yellow seeds (lacks brown pigment in seed coat), lacks anthocyanin in leaves and stems, lacks flavonols
  • CS2105573  — yellow seeds (lacks brown pigment in seed coat), lacks anthocyanin in leaves and stems, lacks flavonols
  • CS66119  — Colorless seed coat.
  • CS66120  — Colorless seed coat.
  • CS66121  — Colorless seed coat.
  • CS71669  — Seeds have a pale transparent testa phenotype. Reduced cell wall rhamnose, but significantly more than the rhm1-3 single mutant (CS71668).
  • CS71670  — Seeds have a pale transparent testa phenotype.
  • CS85  — yellow seeds due to absence of brown pigment in seed coat (testa); pollen has a characteristic lemon-yellow color; anthocyanins absent in leaves, stems and all tissues, this is conspicuous in older plants when chlorophyll starts breaking down, and mutant plants are yellowish; deficient in chalcone synthase activity and lacks flavonoids.
  • CS8584  — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
  • CS8585  — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
  • CS8590  — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
  • CS8592  — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
  • CS8597  — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
  • CS8602  — double mutant; altered phenylpropanoid metabolism; disruption of the synthesis of brown pigment in seed coat (testa), yellow seeds.
  • CS8605  — yellow seeds (lacks brown pigment in seed coat), lacks anthocyanin in leaves and stems.
  • tt4  — pale yellow seeds, no flavonoid in tapetum cells

Literature:

Sequence:

cDNA Sequence
  • >AT5G13930.1 GTTGCAAATATATAAATCAATCAAAAGATTTAAAACCCACCATTCAATCTTGGTAAGTAACGAAAAAAAAGGGAAGCAAGAAGAACCACAGAAAAGGGGGCTAACAACTAGACACGTAGATCTTCATCTGCCCGTCCATCTAACCTACCACACTCTCATCTTCTTTTTCCCGTGTCAGTTTGTTATATAAGCTCTCACTCTCCGGTATATTTCCAAATACACCTAACTTGTTTAGTACACAACAGCAACATCAAACTCTAATAAACCCAAGTTGGTGTATACTATAATGGTGATGGCTGGTGCTTCTTCTTTGGATGAGATCAGACAGGCTCAGAGAGCTGATGGACCTGCAGGCATCTTGGCTATTGGCACTGCTAACCCTGAGAACCATGTGCTTCAGGCGGAGTATCCTGACTACTACTTCCGCATCACCAACAGTGAACACATGACCGACCTCAAGGAGAAGTTCAAGCGCATGTGCGACAAGTCGACAATTCGGAAACGTCACATGCATCTGACGGAGGAATTCCTCAAGGAAAACCCACACATGTGTGCTTACATGGCTCCTTCTCTGGACACCAGACAGGACATCGTGGTGGTCGAAGTCCCTAAGCTAGGCAAAGAAGCGGCAGTGAAGGCCATCAAGGAGTGGGGCCAGCCCAAGTCAAAGATCACTCATGTCGTCTTCTGCACTACCTCCGGCGTCGACATGCCTGGTGCTGACTACCAGCTCACCAAGCTTCTTGGTCTCCGTCCTTCCGTCAAGCGTCTCATGATGTACCAGCAAGGTTGCTTCGCCGGCGGTACTGTCCTCCGTATCGCTAAGGATCTCGCCGAGAACAATCGTGGAGCACGTGTCCTCGTTGTCTGCTCTGAGATCACAGCCGTTACCTTCCGTGGTCCCTCTGACACCCACCTTGACTCCCTCGTCGGTCAGGCTCTTTTCAGTGATGGCGCCGCCGCACTCATTGTGGGGTCGGACCCTGACACATCTGTCGGAGAGAAACCCATCTTTGAGATGGTGTCTGCCGCTCAGACCATCCTTCCAGACTCTGATGGTGCCATAGACGGACATTTGAGGGAAGTTGGTCTCACCTTCCATCTCCTCAAGGATGTTCCCGGCCTCATCTCCAAGAACATTGTGAAGAGTCTAGACGAAGCGTTTAAACCTTTGGGGATAAGTGACTGGAACTCCCTCTTCTGGATAGCCCACCCTGGAGGTCCAGCGATCCTAGACCAGGTGGAGATAAAGCTAGGACTAAAGGAAGAGAAGATGAGGGCGACACGTCACGTGTTGAGCGAGTATGGAAACATGTCGAGCGCGTGCGTTCTCTTCATACTAGACGAGATGAGGAGGAAGTCAGCTAAGGATGGTGTGGCCACGACAGGAGAAGGGTTGGAGTGGGGTGTCTTGTTTGGTTTCGGACCAGGTCTCACTGTTGAGACAGTCGTCTTGCACAGCGTTCCTCTCTAAACAGAACGCTTGCCTTCTATCTGCCTACCTACCTACGCAAAACTTTAATCCTGTCTTATGTTTTATATAATATAATCATTATATGTTTACGCAATAATTAAGGAAGAATTCATTTGATGTGATATGTGATATGTGCTGGACAGGTCTATTCGACTGTTTTTGTACTCTCTTTTTTGTGTCTTTTTACAATATTAAATCTATGGGTCTTGAATGACATCAAATCTTTGTT
CDS Sequence
Protein Sequence