Gene Details:
- Gene ID: AT5G14010
- Gene Symbol: KNU
- Gene Name: KNUCKLES
- Description: C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
- TAIR Accession: locus:2159088
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0009788 — involved in — negative regulation of abscisic acid-activated signaling pathway
- GO:0006355 — acts upstream of or within — regulation of DNA-templated transcription
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0009909 — acts upstream of or within — regulation of flower development
- GO:0005515 — enables — protein binding
- GO:0010582 — acts upstream of or within — floral meristem determinacy
- GO:0003677 — enables — DNA binding
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0005634 — located in — nucleus
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. DOI: 10.1186/1471-2164-5-39 ; PMID: 15236668
- Eukaryotic transcription factors in plastids–Bioinformatic assessment and implications for the evolution of gene expression machineries in plants. DOI: 10.1016/j.gene.2006.06.022 ; PMID: 16934950
- The zinc finger network of plants. DOI: 10.1007/s00018-007-7473-4 ; PMID: 18193167
- A timing mechanism for stem cell maintenance and differentiation in the Arabidopsis floral meristem. DOI: 10.1101/gad.1800409 ; PMID: 19651987
- AGAMOUS terminates floral stem cell maintenance in Arabidopsis by directly repressing WUSCHEL through recruitment of Polycomb Group proteins. DOI: 10.1105/tpc.111.091538 ; PMID: 22028461
- At-MINI ZINC FINGER2 and Sl-INHIBITOR OF MERISTEM ACTIVITY, a Conserved Missing Link in the Regulation of Floral Meristem Termination in Arabidopsis and Tomato. DOI: 10.1105/tpc.17.00653 ; PMID: 29298836
- Tetramerization of MADS family transcription factors SEPALLATA3 and AGAMOUS is required for floral meristem determinacy in Arabidopsis. DOI: 10.1093/nar/gky205 ; PMID: 29562355
- Chromatin-mediated feed-forward auxin biosynthesis in floral meristem determinacy. DOI: 10.1038/s41467-018-07763-0 ; PMID: 30538233
- Integration of Transcriptional Repression and Polycomb-Mediated Silencing of WUSCHEL in Floral Meristems. DOI: 10.1105/tpc.18.00450 ; PMID: 31068455
- Arabidopsis ZINC FINGER PROTEIN1 Acts Downstream of GL2 to Repress Root Hair Initiation and Elongation by Directly Suppressing bHLH Genes. DOI: 10.1105/tpc.19.00226 ; PMID: 31732703
- A PXY-Mediated Transcriptional Network Integrates Signaling Mechanisms to Control Vascular Development in Arabidopsis. DOI: 10.1105/tpc.19.00562 ; PMID: 31806676
- Expression of KNUCKLES in the Stem Cell Domain Is Required for Its Function in the Control of Floral Meristem Activity in Arabidopsis. DOI: 10.3389/fpls.2021.704351 ; PMID: 34367223
- Robust control of floral meristem determinacy by position-specific multifunctions of KNUCKLES. DOI: 10.1073/pnas.2102826118 ; PMID: 34462349
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- A timing mechanism for stem cell maintenance and differentiation in the Arabidopsis floral meristem. DOI: 10.1101/gad.1800409 ; PMID: 19651987
Sequence:
cDNA Sequence
- >AT5G14010.1 ATAAAACCCACACACATCCTTCACTCTTCTCTCTCTCTCTCTCGCTTTTTATTTGCTTTTACTCTCATCTTCTCTATCTCTCTTCCTCTGTAGCTTAAGAACCTCTCAAAAATGGCGGAACCACCACCGTCTTACCTTCATTTCGTAGGTCCTGCAAAAACTCGATCATCAAGCAAACGCCACTCTTTCTCCTCCTCTGCACATCCAGCTTCCCACCGTCTCTTTCCATGTCAGTACTGTCCTCGAAAGTTCTACACATCTCAAGCTCTCGGCGGTCACCAAAACGCTCACAAACGCGAACGCGCCGCTGCTCGTCGTAACCTCGGCGTCCTCGCTAACTCTCCACCCATCCTCGACGACAACAACACGTTTCTTCGTCCTTACCCTTGCTTTTACCAAAACCCATTTCAAGGATCTACTTCTGGAAACGAACCGCTTCAGGAACAGCCGACGATGATGACGATGGATGGCTACGATCCGTTTCATCCGTATCCGTATGTGTACCCTTTTGCATTATCCGGTAACAACAACGACGGAGGAAACGGCGTTATGGAAGAAGACGAGCCTCTCGATCTAGACCTTTCTCTCCGTTTATAAGTTATCTCTGCTTTCTTCTCTGTTTTGTTTTTTGTTCAGATGACTCTTTTAAGTACAACTTTGGAGCTATATATGTACTAGAGTTCCATGTCCTGCTTTTGATTTCCTTGAAAGATAAACTAGCTGCTACCTTTTTTGGATATTACTTATGACGATGATGATGATCGTTTCGATTTTAAGTTTCTGATGA
CDS Sequence
Protein Sequence