Gene Details:
- Gene ID: AT5G14070
- Gene Symbol: ROXY2
- Gene Name:
- Description: Thioredoxin superfamily protein;(source:Araport11)
- TAIR Accession: locus:2174718
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0000122 — acts upstream of or within — negative regulation of transcription by RNA polymerase II
- GO:0045892 — acts upstream of or within — negative regulation of DNA-templated transcription
- GO:0005515 — enables — protein binding
- GO:0005634 — located in — nucleus
- GO:0048653 — acts upstream of or within — anther development
- GO:0045892 — involved in — negative regulation of DNA-templated transcription
- GO:0048653 — involved in — anther development
- GO:0005737 — is active in — cytoplasm
- GO:0009507 — located in — chloroplast
- GO:0005634 — is active in — nucleus
Function-related keywords:
Literature:
- Peroxiredoxin Q of Arabidopsis thaliana is attached to the thylakoids and functions in context of photosynthesis. DOI: 10.1111/j.1365-313X.2006.02665.x ; PMID: 16507087
- Genome-wide analysis of plant glutaredoxin systems. DOI: 10.1093/jxb/erl001 ; PMID: 16720602
- Evolution of redoxin genes in the green lineage. DOI: 10.1007/s11120-006-9095-3 ; PMID: 17031546
- ROXY1 and ROXY2, two Arabidopsis glutaredoxin genes, are required for anther development. DOI: 10.1111/j.1365-313X.2007.03375.x ; PMID: 18036205
- Origin and diversification of land plant CC-type glutaredoxins. DOI: 10.1093/gbe/evp025 ; PMID: 20333196
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Arabidopsis basic leucine-zipper transcription factors TGA9 and TGA10 interact with floral glutaredoxins ROXY1 and ROXY2 and are redundantly required for anther development. DOI: 10.1104/pp.110.159111 ; PMID: 20805327
- Repression of the Arabidopsis thaliana jasmonic acid/ethylene-induced defense pathway by TGA-interacting glutaredoxins depends on their C-terminal ALWL motif. DOI: 10.1093/mp/ssr113 ; PMID: 22207719
- The Arabidopsis LFR gene is required for the formation of anther cell layers and normal expression of key regulatory genes. DOI: 10.1093/mp/sss024 ; PMID: 22461668
Sequence:
cDNA Sequence
- >AT5G14070.1 GTTAAATTTAGAACTTCACCATGTATAAATACTCTGCATGCCTCTCACTCTCTCCCCAACCAACTCTCACACAAATTCTCTCGCTCTCTCACTCTCTTATTCTCTTTCTCTTTTTCTCTAAGAATACAAAAAAAGATGCAATACAAAACAGAAACTCGAGGGTCGTTGTCCTACAACAACAACAGTAAGGTGATGAACAACATGAATGTGTTTCCGTCGGAGACACTGGCGAAGATAGAGTCGATGGCGGCAGAGAATGCGGTGGTTATATTCAGCGTGAGCACTTGCTGCATGTGCCATGCCATCAAGCGTCTCTTCCGTGGAATGGGCGTCAGCCCCGCCGTCCACGAGCTCGACCTCCTCCCTTACGGAGTTGAAATCCACCGAGCTCTCCTCCGTCTCCTTGGCTGTTCCAGCGGTGGCGCCACATCTCCGGGGGCACTTCCGGTGGTGTTCATCGGAGGGAAGATGGTAGGAGCAATGGAGAGAGTGATGGCTTCACATATCAATGGCTCACTCGTCCCTCTTCTCAAAGATGCTGGCGCTCTTTGGCTCTGATGAGTGCTAATCTCATCCTCCAAATATCAACCTTTGGTTTATCTTTGGTTTTTAAGGACAGAAGAAATAGGTTAATCCCAGTGTTGAATTAGAGACAGTGAGAGAGAAGAGTGATGCGTTTGTTTTAAGCTTAGCTCTTTGTCTATCTTAAATCACACTAATATATAAATGTTAACTAATCGCTATGTCTCTTGTTAGCTTTCTTATCTCTAATTTTACAATTTGACAGTTGATTTGCAAAATTTAAT
CDS Sequence
Protein Sequence