Gene Details:
- Gene ID: AT5G15160
- Gene Symbol: BHLH134, BNQ2
- Gene Name: BASIC HELIX-LOOP-HELIX PROTEIN 134, BANQUO 2
- Description: BANQUO 2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Literature:
- The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. DOI: 10.1093/molbev/msg088 ; PMID: 12679534
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Update on the basic helix-loop-helix transcription factor gene family in Arabidopsis thaliana. DOI: 10.1105/tpc.151140 ; PMID: 14600211
- Microarray analysis of genes that respond to gamma-irradiation in Arabidopsis. DOI: 10.1021/jf0486895 ; PMID: 15713015
- A gradient of auxin and auxin-dependent transcription precedes tropic growth responses. DOI: 10.1073/pnas.0507127103 ; PMID: 16371470
- Overexpression of PRE1 and its homologous genes activates Gibberellin-dependent responses in Arabidopsis thaliana. DOI: 10.1093/pcp/pcj026 ; PMID: 16527868
- Synteny conservation between the Prunus genome and both the present and ancestral Arabidopsis genomes. DOI: 10.1186/1471-2164-7-81 ; PMID: 16615871
- KIDARI, encoding a non-DNA Binding bHLH protein, represses light signal transduction in Arabidopsis thaliana. DOI: 10.1007/s11103-006-0010-2 ; PMID: 16786307
- Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. DOI: 10.1111/j.1365-313X.2006.02889.x ; PMID: 17059409
- Developmental steps in acquiring competence for shoot development in Arabidopsis tissue culture. DOI: 10.1007/s00425-007-0565-4 ; PMID: 17581762
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Regulation of Arabidopsis brassinosteroid signaling by atypical basic helix-loop-helix proteins. DOI: 10.1105/tpc.109.072504 ; PMID: 20023194
- Antagonistic HLH/bHLH transcription factors mediate brassinosteroid regulation of cell elongation and plant development in rice and Arabidopsis. DOI: 10.1105/tpc.109.070441 ; PMID: 20009022
- The Arabidopsis floral homeotic proteins APETALA3 and PISTILLATA negatively regulate the BANQUO genes implicated in light signaling. DOI: 10.1105/tpc.109.065946 ; PMID: 20305124
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- The G-Box Transcriptional Regulatory Code in Arabidopsis. DOI: 10.1104/pp.17.01086 ; PMID: 28864470
- PACLOBUTRAZOL-RESISTANCE Gene Family Regulates Floral Organ Growth with Unequal Genetic Redundancy in Arabidopsis thaliana. DOI: 10.3390/ijms20040869 ; PMID: 30781591
- Overexpression of HLH4 Inhibits Cell Elongation and Anthocyanin Biosynthesis in Arabidopsis thaliana. DOI: 10.3390/cells11071087 ; PMID: 35406652
- The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. DOI: 10.1093/molbev/msg088 ; PMID: 12679534
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
Sequence:
cDNA Sequence
- >AT5G15160.1 CCAAGACTCCAATTCTAAACCACTGTTCTCTCTTGTGCACTTGTCATCGGCATATCCAACACCCCTATTTAAGATTATTTGTATTACTCTCGCTCTCTCTCTCTCTCTCTATCTAGAAGTGGTCCTAGCTCTCTATATAACACCATTTCTTCTCCTTCTTTCTTCTCCCTTTCTTTCGACAAGCACAAACAAAGCCATCAAGAGAAGAAAGCCTTTTCTTGGATTCACATATATATAAGAATATTTTTTCAAATCAAACATGTCTTCTAGCAGAAGGTCGAGACAAGCAAGCTCATCATCAAGAATTAGCGATGACCAGATCACTGATCTCATCTCAAAGCTCCGACAGTCCATTCCGGAGATTCGCCAGAACCGTCGTTCCAACACGGTATCAGCGTCGAAAGTGTTACAAGAGACTTGCAACTACATAAGAAACTTGAACAAGGAAGCCGATGACCTCAGTGATCGATTGACTCAGCTTCTGGAATCCATTGATCCTAATAGCCCACAAGCCGCAGTTATTAGGAGCTTGATTAATGGATAATTAAGATATAAATTGATTAGTTGTGCTTTATATATATAAGCTTAAAATCTCGTTGGGAGGTTGATCCATCAGGGTGTTGCATAATTATATATCTATTTTATGTTTCTTATATATTATTTACAATCCTATCTAGTTAGGGTTCATATTTTGACCCTTTTTTGGTTTAACGTCATGCATGCAATTCCATTAAGCTTAAAAATTATAATAAATAAGATTTCGAGTAATTATTTAATTTAAATCCTTT
CDS Sequence
Protein Sequence