Gene Details:
- Gene ID: AT5G15350
- Gene Symbol: AtENODL17, ENODL17
- Gene Name: early nodulin-like protein 17
- Description: early nodulin-like protein 17;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis. DOI: 10.1104/pp.010884 ; PMID: 12068095
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- Microarray expression analyses of Arabidopsis guard cells and isolation of a recessive abscisic acid hypersensitive protein phosphatase 2C mutant. DOI: 10.1105/tpc.019000 ; PMID: 14973164
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Localization of organelle proteins by isotope tagging (LOPIT). DOI: 10.1074/mcp.T400009-MCP200 ; PMID: 15295017
- A quantitative analysis of Arabidopsis plasma membrane using trypsin-catalyzed (18)O labeling. DOI: 10.1074/mcp.M500414-MCP200 ; PMID: 16635983
- An early nodulin-like protein accumulates in the sieve element plasma membrane of Arabidopsis. DOI: 10.1104/pp.106.092296 ; PMID: 17293437
- Phosphatidylinositol 4-kinase activation is an early response to salicylic acid in Arabidopsis suspension cells. DOI: 10.1104/pp.107.100842 ; PMID: 17496105
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Genome-wide identification, structure and expression studies, and mutant collection of 22 early nodulin-like protein genes in Arabidopsis. DOI: 10.1271/bbb.90407 ; PMID: 19897921
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Proteomic analysis of glycosylphosphatidylinositol-anchored membrane proteins. DOI: 10.1074/mcp.M300079-MCP200 ; PMID: 14517339
Sequence:
cDNA Sequence
- >AT5G15350.1 CGGTTAAACATAATTTTTGAGTTTTGTTATATTTTTAGAAAGTTATTGATTAATATATTCAGTACTCTCACTAAACAGAGGTTGAAAAAGGAAATAAAAAAATGGGCTATTAATATTTTCACAAACATAAATAAACCCACTAGTCCATCTCTCTAAATCACAAATTGCGCAACTTACAACATCTATAGAGAGAGAGAGAGAGAGTTTAGTTAGAGAGAAAAAAATGGCGAGATTCACGGTGCTGATTACGGCGGTTGTGCTAGCTTTTCTAATGGCGGCGCCGATGCCAGGAGTGACGGCCAAGAAGTATACAGTCGGCGAGAACAAGTTTTGGAACCCCAACATTAACTACACCATCTGGGCTCAGGGCAAGCATTTCTACCTCGGAGACTGGCTCTATTTCGTGTTCGACAGAAACCAGCACAATATTCTTGAAGTGAACAAGACTGACTATGAAGGATGTATCGCCGACCACCCAATACGCAACTGGACACGTGGAGCTGGGAGAGACATTGTCACTCTCAACCAGACCAAGCATTACTACCTTCTCGACGGAAAGGGTGGATGTTACGGTGGCATGAAGCTATCTGTTAAAGTAGAGAAGCTTCCTCCTCCACCAAAATCTGCACCTGTCAAGAACATTGGATCGGTTTCAATGGTCACAGGTCTCGCTCAATTCATGATTCCGGTATCTCTATTCGCTTTCCCTGCAATGTGGGATGTGATCTCAAGGATGTGGTAGTAGTCACCAGTCTTCAAAGTTCTTTAGTTGAATCGAAACCGACCTCAAAAATTCTTTTCAGGGAAACCTTTTTAATTTAGTTGAGTTTCTCTTTTCTCTTTGTAATGTTGGATTGTTGGTTTTCCTTTAATCTTTTGCCTTTGAATTGATTGTTAAAGAAAGATTGTATTTGATTTATTTGAGAAATTAAATTACTGAAATTTTCTTAAGATGCAAAAAAATCTCAAAATTCTTGCTTTGTTGGAAGTGAATGAGCTGTGGATCA
CDS Sequence
Protein Sequence