Gene Details:
- Gene ID: AT5G15530
- Gene Symbol: BCCP2, CAC1-B
- Gene Name: biotin carboxyl carrier protein 2
- Description: biotin carboxyl carrier protein 2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Function-related keywords:
Literature:
- Contrapuntal networks of gene expression during Arabidopsis seed filling. DOI: 10.1105/tpc.000877 ; PMID: 12084821
- Both antisense and sense expression of biotin carboxyl carrier protein isoform 2 inactivates the plastid acetyl-coenzyme A carboxylase in Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.2002.01435.x ; PMID: 12445115
- Arabidopsis genes involved in acyl lipid metabolism. A 2003 census of the candidates, a study of the distribution of expressed sequence tags in organs, and a web-based database. DOI: 10.1104/pp.103.022988 ; PMID: 12805597
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Isolation, sequence analysis, and expression studies of florally expressed cDNAs in Arabidopsis. DOI: 10.1023/B:PLAN.0000019063.18097.62 ; PMID: 15010618
- Delayed embryo development in the ARABIDOPSIS TREHALOSE-6-PHOSPHATE SYNTHASE 1 mutant is associated with altered cell wall structure, decreased cell division and starch accumulation. DOI: 10.1111/j.1365-313X.2006.02662.x ; PMID: 16553896
- WRINKLED1 specifies the regulatory action of LEAFY COTYLEDON2 towards fatty acid metabolism during seed maturation in Arabidopsis. DOI: 10.1111/j.1365-313X.2007.03092.x ; PMID: 17419836
- Dual targeting of Arabidopsis holocarboxylase synthetase1: a small upstream open reading frame regulates translation initiation and protein targeting. DOI: 10.1104/pp.107.111534 ; PMID: 18156294
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Articulation of three core metabolic processes in Arabidopsis: fatty acid biosynthesis, leucine catabolism and starch metabolism. DOI: 10.1186/1471-2229-8-76 ; PMID: 18616834
- LEAFY COTYLEDON1 is a key regulator of fatty acid biosynthesis in Arabidopsis. DOI: 10.1104/pp.108.126342 ; PMID: 18689444
- System analysis of an Arabidopsis mutant altered in de novo fatty acid synthesis reveals diverse changes in seed composition and metabolism. DOI: 10.1104/pp.108.134882 ; PMID: 19279196
- Chloroplast acetyl-CoA carboxylase activity is 2-oxoglutarate-regulated by interaction of PII with the biotin carboxyl carrier subunit. DOI: 10.1073/pnas.0910097107 ; PMID: 20018655
- Acyl-lipid metabolism. DOI: 10.1199/tab.0161 ; PMID: 23505340
- TRANSPARENT TESTA2 regulates embryonic fatty acid biosynthesis by targeting FUSCA3 during the early developmental stage of Arabidopsis seeds. DOI: 10.1111/tpj.12426 ; PMID: 24397827
- BnWRI1 coordinates fatty acid biosynthesis and photosynthesis pathways during oil accumulation in rapeseed. DOI: 10.1111/jipb.12158 ; PMID: 24393360
- A Family of Negative Regulators Targets the Committed Step of de Novo Fatty Acid Biosynthesis. DOI: 10.1105/tpc.16.00317 ; PMID: 27559025
- Biotin Attachment Domain-Containing Proteins Irreversibly Inhibit Acetyl CoA Carboxylase. DOI: 10.1104/pp.18.00216 ; PMID: 29626162
- Design of a Seed-Specific Chimeric Promoter with a Modified Expression Profile to Improve Seed Oil Content. DOI: 10.3390/ijms19061667 ; PMID: 29874815
- AtMYB92 enhances fatty acid synthesis and suberin deposition in leaves of Nicotiana benthamiana. DOI: 10.1111/tpj.14759 ; PMID: 32246506
- The BADC and BCCP subunits of chloroplast acetyl-CoA carboxylase sense the pH changes of the light-dark cycle. DOI: 10.1074/jbc.RA120.012877 ; PMID: 32467229
- Differential Activation of Partially Redundant Δ9 Stearoyl-ACP Desaturase Genes Is Critical for Omega-9 Monounsaturated Fatty Acid Biosynthesis During Seed Development in Arabidopsis. DOI: 10.1105/tpc.20.00554 ; PMID: 32958563
Sequence:
cDNA Sequence
- >AT5G15530.1 GTTGGATTTGTGAAACAAATGCAGATTACATGGAGGCAATCTCTGAAAGACTGTTCCGGTGATTAGACCAGTAACACATGTATAGCTGAACACACATATCTATACATATCTATATCTATCTATATTGGTGTATTTTGTGTATATACTAAAAAATAAGACAGAGAAACACCGAGGCACTATGTTATGACATGGCACGATTGAACTGATAGAAGACAAAAGGAGCGGTTTGGTGAAGTTAGTTAAAAGAGTTGGGTTTCTTCGTAAGCATCGAAATCAGATTTCTTTACCAAAGAAAAAATAAAGAAAAGAAAAATATAGCAAGTACACTGCATTTCAACACTCTCATATCTCTCCTTCCTACTTCCTCGGTTTCATCGTCCACTGTCTCAACAATGGCGTCATTGTCGGTACCTTGCGTCAAGATCTGTGCTCTGAACAGGCGGGTCGGATCTCTCCCTGGAATCTCTACTCAAAGATGGCAGCCGCAACCCAATGGGATCTCCTTTCCCTCCGATGTTTCTCAGAATCATTCTGCATTCTGGAGGTTGCGTGCAACAACTAATGAGGTTGTTTCTAACTCCACTCCAATGACTAATGGTGGGTATATGAACGGAAAAGCGAAAACCAATGTTCCTGAACCCGCCGAGCTCTCTGAATTTATGGCTAAAGTCTCTGGTCTTCTTAAGCTTGTGGATTCAAAAGACATAGTGGAACTTGAACTAAAGCAGCTCGACTGTGAGATCGTTATTCGAAAGAAGGAAGCTTTACAGCAAGCTGTACCACCAGCTCCAGTTTATCACTCAATGCCTCCTGTAATGGCAGACTTTTCAATGCCTCCAGCTCAACCAGTGGCTCTTCCTCCTTCTCCTACTCCTACCTCAACGCCTGCAACAGCAAAACCAACATCCGCCCCATCCTCGTCTCATCCTCCACTCAAGAGTCCCATGGCTGGTACTTTCTATAGATCTCCTGGACCCGGTGAACCCCCTTTTGTAAAGGTTGGAGATAAGGTACAGAAGGGTCAAATTGTTTGTATTATCGAAGCTATGAAACTGATGAACGAGATTGAGGCTGAGAAGTCAGGAACCATCATGGAACTACTGGCTGAAGATGGAAAACCAGTCAGCGTTGACACGCCTCTTTTTGTCATCGCACCTTGAAACGAAGAAGGATCCTTTTAGCTGCTTCAAAACATCTTCAAAGTCTCGGTTAAGCTATAGCAACGTGCTAAAACTCATCAAGTAATTATTTCAGCTTAAGTTGGTTGGTTTCGGATTTCTGCTTGTCGCTTCAATAATTGACCCATCTTTTGGGATTTCACGTAACGTACTACACTTTGCTTTTTAGTTTTCTGCGAAACTAATGTATTTTGTAGCCTCTCAATCCTGGCTCTCTGTCCCATACTTCAGTTTTTTACACAACGCACTGCTTATAAAAGCACAGTTAAAGGTGTCTAAAGGAGAATGGTGTGTCTTTGACTGAGGCAACAAATAAAACAGTGAAAAGTTAAGGTTTTACATGATGCATTACCTTAATAAAACATGTTTCCATGTTTTCATCTAT
CDS Sequence
Protein Sequence