Gene Details:
- Gene ID: AT5G16240
- Gene Symbol: AAD1
- Gene Name: ACYL-ACYL CARRIER PROTEIN DESATURASE1
- Description:
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Germplasm Phenotype:
- aad1 aad5 aad6 fab2 — Increased proportions of C18:0 and their elongated derivatives (C20:0 and C22:0), concomitantly decreased levels of &
- aad1 aad5 fab2 — Increased proportions of C18:0 and their elongated derivatives (C20:0 and C22:0), concomitantly decreased levels of &
Function-related keywords:
Literature:
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- Changes in the endoplasmic reticulum lipid properties in response to low temperature in Brassica napus. DOI: 10.1016/j.plaphy.2004.10.001 ; PMID: 15596101
- Genomic structures and characterization of the 5'-flanking regions of acyl carrier protein and Delta4-palmitoyl-ACP desaturase genes from Coriandrum sativum. DOI: 10.1016/j.bbaexp.2005.06.011 ; PMID: 16112758
- Immediate-early and delayed cytokinin response genes of Arabidopsis thaliana identified by genome-wide expression profiling reveal novel cytokinin-sensitive processes and suggest cytokinin action through transcriptional cascades. DOI: 10.1111/j.1365-313X.2005.02530.x ; PMID: 16212609
- Cuticular lipid composition, surface structure, and gene expression in Arabidopsis stem epidermis. DOI: 10.1104/pp.105.070805 ; PMID: 16299169
- The Arabidopsis stearoyl-acyl carrier protein-desaturase family and the contribution of leaf isoforms to oleic acid synthesis. DOI: 10.1007/s11103-006-9086-y ; PMID: 17072561
- Proteomic and transcriptomic analysis of Arabidopsis seeds: molecular evidence for successive processing of seed proteins and its implication in the stress response to sulfur nutrition. DOI: 10.1111/j.1365-313X.2006.02900.x ; PMID: 17059406
- LEAFY COTYLEDON1 is a key regulator of fatty acid biosynthesis in Arabidopsis. DOI: 10.1104/pp.108.126342 ; PMID: 18689444
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Autophosphorylation profiling of Arabidopsis protein kinases using the cell-free system. DOI: 10.1016/j.phytochem.2011.02.029 ; PMID: 21477822
- Acyl-lipid metabolism. DOI: 10.1199/tab.0161 ; PMID: 23505340
- Transcriptional dynamics of two seed compartments with opposing roles in Arabidopsis seed germination. DOI: 10.1104/pp.113.223511 ; PMID: 23858430
- ACYL-ACYL CARRIER PROTEIN DESATURASE2 and 3 Are Responsible for Making Omega-7 Fatty Acids in the Arabidopsis Aleurone. DOI: 10.1104/pp.16.00836 ; PMID: 27462083
- Conserved Function of ACYL-ACYL CARRIER PROTEIN DESATURASE 5 on Seed Oil and Oleic Acid Biosynthesis between Arabidopsis thaliana and Brassica napus. DOI: 10.3389/fpls.2017.01319 ; PMID: 28791041
- Differential Activation of Partially Redundant Δ9 Stearoyl-ACP Desaturase Genes Is Critical for Omega-9 Monounsaturated Fatty Acid Biosynthesis During Seed Development in Arabidopsis. DOI: 10.1105/tpc.20.00554 ; PMID: 32958563
Sequence:
cDNA Sequence
- >AT5G16240.1 GACATTTAAGAGACTTTCAAACAGAGTCGTTTATGCAATAAATGCACACACACTTGCTGAAATAATCACGTTCCAGAGAGTTTTCTGAAATTGATCGTTTTGGTTCTTCACCTTTCCTTTTCTTTGCTTTCTGCTTCCTCCCTTAAATACATTTCACTCTGTTATCATCGATTTTTTTTTCTTATATCTCAATCTTATTTTGTTTGTCTTTTCTCCATTTTTGTTTCGTTAAGAAGAAACAATGGTTATGGCTATGGATCGGATCGCTTTGTTCTCTTCCTCATCATCTGTTTATCATCACGGTTCTTCTCATTCTCATGGCTCCAAATCTTCCAGAGTTTTCACTATTCGTTCCGACTCTACAGCGGTTGGAAGGAAACTGTATATTCCTCCTCGAGAGGTTCATCTTCAAGTGAAGTATTCAATGCCACCACAAAAGCTGGAGATTTTCAAGTCCTTAGAAGGATGGGCTAATGACAACTTGTTGGCTTACTTAAAACCTGTTGAGAAATCATGGCAACCAACTGATTTTCTCCCTGAACCTGAGTCAGAAGGATTCTATGACCAAGTTAAGGAGTTAAGAGAAAGGTGTAAGGAGCTCTCTGATGACTACCTTATAGTGCTTGTTGGTGATATGATCACAGAGGAAGCACTTCCGACTTATCAGACCATGATTAATACATTGGACGGGGTTAGAGATGAGACGGGAGCAAGTCCAACTCCTTGGGCAGTATGGACTAGGGCATGGACTGCGGAAGAGAATAGACATGGTGATCTTCTTAACAAGTACCTTTATCTGTCTGGACGAGTAGACATGAGACAGATTGAAAAAACTATTCAATACCTCATTGGTTCTGGAATGGATCCAAAAACTGAAAACAATCCTTACTTGGGATTCATATATACTTCTTTTCAAGAAAGAGCTACATTCATCTCCCATGGAAACACTGCTAGACTGGCAAAGGATCTTGGAGACTTGACACTTGGGAAGATTTGTGGCACCATTGCTGCTGATGAGAGGCGCCATGAACACGCCTACACCAAGATTGTAGAGAAGCTCTTTGAAATTGATCCTGATACCACAGTCGTGGGCTTTGCTGACATGATGAGGAAAAAGATCTCGATGCCTGCTCATTTGATGTATGATGGTCGTGATGATAATCTATTTGATCACTTCTCGTCCGTGGCCCAGAGGCTTGGTGTCTACACTGCCAAGGACTATGCTGATATACTGCAACATCTTGTGGAAAGGTGGAATGTGGAGAAGTTGTCAGACCTTTCTAGTGAAGGAAACAGGGCCCAGGACTACCTCTGTGGATTACCTGCTAGAATCCGCAAACTTGAAGAGAGGGCTCAAGGGAGAACCAAAGAAGCAGCAAAAAACATACCATTCAGCTGGATTTTTGGTCGAGAAGTCAGGGCTTAAAAGAAGTAATGTTAAGCAATTAATTCTTCCATATTATAATCCCAAGCAAGCTATAAAAGATCTTCACCAACACCTTGATGAAGAAGCCAGAAGTATGTTATGTTGGAAACGTGTGTAGATAAAGTATGTGTTAGACTTTGCTTTGTTTGGATCACTTAAATGACTTACTCCAAAGAATTTGCTTTGTTTTGACGATTTTATTTATTTATTTCTGCACCTCTATTTGTTGCTAGTATTGAATCCACTTCTGTAATGTTTTCTCTTCTTCTGAATCCAATAAGATATTTAAAAAGTAAAATTTTGTGTTTCGTTCTCTCTACTT
CDS Sequence
Protein Sequence