Gene Details:
- Gene ID: AT5G17050
- Gene Symbol: UGT78D2
- Gene Name: UDP-glucosyl transferase 78D2
- Description: UDP-glucosyl transferase 78D2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- The activity of Arabidopsis glycosyltransferases toward salicylic acid, 4-hydroxybenzoic acid, and other benzoates. DOI: 10.1074/jbc.M109287200 ; PMID: 11641410
- UGT73C6 and UGT78D1, glycosyltransferases involved in flavonol glycoside biosynthesis in Arabidopsis thaliana. DOI: 10.1074/jbc.M303523200 ; PMID: 12900416
- Arabidopsis glycosyltransferases as biocatalysts in fermentation for regioselective synthesis of diverse quercetin glucosides. DOI: 10.1002/bit.20154 ; PMID: 15352060
- Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis. DOI: 10.1111/j.1365-313X.2005.02399.x ; PMID: 15860015
- KaPPA-view: a web-based analysis tool for integration of transcript and metabolite data on plant metabolic pathway maps. DOI: 10.1104/pp.105.060525 ; PMID: 16010003
- Elucidation of gene-to-gene and metabolite-to-gene networks in arabidopsis by integration of metabolomics and transcriptomics. DOI: 10.1074/jbc.M502332200 ; PMID: 15866872
- A UV-B-specific signaling component orchestrates plant UV protection. DOI: 10.1073/pnas.0507187102 ; PMID: 16330762
- MAX1, a regulator of the flavonoid pathway, controls vegetative axillary bud outgrowth in Arabidopsis. DOI: 10.1073/pnas.0509463102 ; PMID: 16387852
- Transcriptional coordination of the metabolic network in Arabidopsis. DOI: 10.1104/pp.106.080358 ; PMID: 16920875
- Analysis of transcription factor HY5 genomic binding sites revealed its hierarchical role in light regulation of development. DOI: 10.1105/tpc.106.047688 ; PMID: 17337630
- Genome-wide analysis of Arabidopsis responsive transcriptome to nitrogen limitation and its regulation by the ubiquitin ligase gene NLA. DOI: 10.1007/s11103-007-9241-0 ; PMID: 17885809
- Redox state of plastoquinone pool regulates expression of Arabidopsis thaliana genes in response to elevated irradiance. DOI: 20081565 ; PMID: 18231654
- Light has a specific role in modulating Arabidopsis gene expression at low temperature. DOI: 10.1186/1471-2229-8-13 ; PMID: 18230142
- Adaptation of Arabidopsis to nitrogen limitation involves induction of anthocyanin synthesis which is controlled by the NLA gene. DOI: 10.1093/jxb/ern148 ; PMID: 18552353
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Comprehensive flavonol profiling and transcriptome coexpression analysis leading to decoding gene-metabolite correlations in Arabidopsis. DOI: 10.1105/tpc.108.058040 ; PMID: 18757557
- The formation of Anthocyanic Vacuolar Inclusions in Arabidopsis thaliana and implications for the sequestration of anthocyanin pigments. DOI: 10.1093/mp/ssp071 ; PMID: 20085894
- The ABORTED MICROSPORES regulatory network is required for postmeiotic male reproductive development in Arabidopsis thaliana. DOI: 10.1105/tpc.109.071803 ; PMID: 20118226
- Karrikins enhance light responses during germination and seedling development in Arabidopsis thaliana. DOI: 10.1073/pnas.0911635107 ; PMID: 20351290
- Feedback inhibition of the general phenylpropanoid and flavonol biosynthetic pathways upon a compromised flavonol-3-O-glycosylation. DOI: 10.1093/jxb/err416 ; PMID: 22249996
- Regioselective synthesis of flavonoid bisglycosides using Escherichia coli harboring two glycosyltransferases. DOI: 10.1007/s00253-013-4844-7 ; PMID: 23549747
- Comparative genomic and transcriptomic analyses of Family-1 UDP glycosyltransferase in three Brassica species and Arabidopsis indicates stress-responsive regulation. DOI: 10.1038/s41598-018-19535-3 ; PMID: 29382843
- The Peroxidative Cleavage of Kaempferol Contributes to the Biosynthesis of the Benzenoid Moiety of Ubiquinone in Plants. DOI: 10.1105/tpc.18.00688 ; PMID: 30429224
- 3-O-glycosylation of kaempferol restricts the supply of the benzenoid precursor of ubiquinone (Coenzyme Q) in Arabidopsis thaliana. DOI: 10.1016/j.phytochem.2021.112738 ; PMID: 33756238
- Cell type-specific proteomics uncovers a RAF15-SnRK2.6/OST1 kinase cascade in guard cells. DOI: 10.1111/jipb.13536 ; PMID: 37226855
- Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing an MYB transcription factor. DOI: 10.1111/j.1365-313X.2005.02371.x ; PMID: 15807784
- MAX1, a regulator of the flavonoid pathway, controls vegetative axillary bud outgrowth in Arabidopsis. DOI: 10.1073/pnas.0509463102 ; PMID: 16387852
- Anthocyaninless1 gene of Arabidopsis thaliana encodes a UDP-glucose:flavonoid-3-O-glucosyltransferase. DOI: 10.1007/s10265-006-0067-7 ; PMID: 17277900
Sequence:
cDNA Sequence
- >AT5G17050.1 ATTTGATTAAAAAAGTTGTTTACTTGTTATATAAAGAAAGAGAAGAGATCGGTACCAACCACGAAACACGAGCTTTACACTTGCTCGGTGGTTCATTTACGACCACACTCTCTCTTCTCTTTAGCCCTCTCCTCTCTATTTATTCTCCAACAAACTCTCTCTTCTCTTTTCAAGTCTTCTTCTTCATTACTCGCACCATGACCAAACCCTCCGACCCAACCAGAGACTCCCACGTGGCAGTTCTCGCTTTTCCTTTCGGCACTCATGCAGCTCCTCTCCTCACCGTCACGCGCCGCCTCGCCTCCGCCTCTCCTTCCACCGTCTTCTCTTTCTTCAACACCGCACAATCCAACTCTTCGTTATTTTCCTCCGGTGACGAAGCAGATCGTCCGGCGAACATCAGAGTATACGATATTGCCGACGGTGTTCCGGAGGGATACGTGTTTAGCGGGAGACCACAGGAGGCGATCGAGCTGTTTCTTCAAGCTGCGCCGGAGAATTTCCGGAGAGAAATCGCGAAGGCGGAGACGGAGGTTGGTACGGAAGTGAAATGTTTGATGACTGATGCGTTCTTCTGGTTCGCGGCTGATATGGCGACGGAGATAAATGCGTCGTGGATTGCGTTTTGGACCGCCGGAGCAAACTCACTCTCTGCTCATCTCTACACAGATCTCATCAGAGAAACCATCGGTGTCAAAGAAGTAGGTGAGCGTATGGAGGAGACAATAGGGGTTATCTCAGGAATGGAGAAGATCAGAGTCAAAGATACACCAGAAGGAGTTGTGTTTGGGAATTTAGACTCTGTTTTCTCAAAGATGCTTCATCAAATGGGTCTTGCTTTGCCTCGTGCCACTGCTGTTTTCATCAATTCTTTTGAAGATTTGGATCCTACATTGACGAATAACCTCAGATCGAGATTTAAACGATATCTGAACATCGGTCCTCTCGGGTTATTATCTTCTACATTGCAACAACTAGTGCAAGATCCTCACGGTTGTTTGGCTTGGATGGAGAAGAGATCTTCTGGTTCTGTGGCGTACATTAGCTTTGGTACGGTCATGACACCGCCTCCTGGAGAGCTTGCGGCGATAGCAGAAGGGTTGGAATCGAGTAAAGTGCCGTTTGTTTGGTCGCTTAAGGAGAAGAGCTTGGTTCAGTTACCAAAAGGGTTTTTGGATAGGACAAGAGAGCAAGGGATAGTGGTTCCATGGGCACCGCAAGTGGAACTGCTGAAACACGAAGCAACGGGTGTGTTTGTGACGCATTGTGGATGGAACTCGGTGTTGGAGAGTGTATCGGGTGGTGTACCGATGATTTGCAGGCCATTTTTTGGGGATCAGAGATTGAACGGAAGAGCGGTGGAGGTTGTGTGGGAGATTGGAATGACGATTATCAATGGAGTCTTCACGAAAGATGGGTTTGAGAAGTGTTTGGATAAAGTTTTAGTTCAAGATGATGGTAAGAAGATGAAATGTAATGCTAAGAAACTTAAAGAACTAGCTTACGAAGCTGTCTCTTCTAAAGGAAGGTCCTCTGAGAATTTCAGAGGATTGTTGGATGCAGTTGTAAACATTATTTGAATGTGAAATGATTTTGGACAAATAAATAACAACAGTTTCT
CDS Sequence
Protein Sequence