Gene Details:
- Gene ID: AT5G17400
- Gene Symbol: ER-ANT1
- Gene Name: endoplasmic reticulum-adenine nucleotide transporter 1
- Description: endoplasmic reticulum-adenine nucleotide transporter 1;(source:Araport11)
- TAIR Accession: locus:2178925
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0048316 — acts upstream of or within — seed development
- GO:0048367 — acts upstream of or within — shoot system development
- GO:0140021 — involved in — mitochondrial ADP transmembrane transport
- GO:0005471 — enables — ATP:ADP antiporter activity
- GO:0048364 — acts upstream of or within — root development
- GO:1990544 — involved in — mitochondrial ATP transmembrane transport
- GO:0051503 — acts upstream of or within — adenine nucleotide transport
- GO:0005789 — located in — endoplasmic reticulum membrane
- GO:0005743 — located in — mitochondrial inner membrane
- GO:0005739 — located in — mitochondrion
Germplasm Phenotype:
- SALK_043626 — photorespiratory phenotype accompanied by high glycine levels and stunted growth
- SALK_043626C — er-ant1-KO1 mutants have reduced apical dominance and a prolonged life cycle. The mutants have smaller seeds with reduced seed lipid and seed oil content. Seedling roots grow normally in 0.5% agar, but show reduced growth relative to wild-type roots in 1.5% and 1% agar. This may result from defects in pectic polysaccharide mucilage secretion which is an ER-dependent process. The transcript levels for some ER chaperones (BiP1/2, Bip3) and two proteins that depend on sufficient ATP levels in the ER lumen (CPK2 and SEC61gamma) are reduced in the er-ant-KO1 mutants.
- er-ant1-KO2 — er-ant1-KO2 mutants have reduced apical dominance and a prolonged life cycle. The mutants have smaller seeds with reduced seed lipid and seed oil content. Seedling roots grow normally in 0.5% agar, but show reduced growth relative to wild-type roots in 1.5% and 1% agar. This may result from defects in pectic polysaccharide mucilage secretion which is an ER-dependent process. The transcript levels for some ER chaperones (BiP1/2, Bip3) and two proteins that depend on sufficient ATP levels in the ER lumen (CPK2 and SEC61gamma) are reduced in the er-ant-KO2 mutants.
Function-related keywords:
Literature:
- Genomic and proteomic analysis of mitochondrial carrier proteins in Arabidopsis. DOI: 10.1104/pp.009985 ; PMID: 12586869
- The growing family of mitochondrial carriers in Arabidopsis. DOI: 10.1016/j.tplants.2004.01.007 ; PMID: 15003237
- Integrating membrane transport with male gametophyte development and function through transcriptomics. DOI: 10.1104/pp.105.074708 ; PMID: 16607029
- Identification of a novel adenine nucleotide transporter in the endoplasmic reticulum of Arabidopsis. DOI: 10.1105/tpc.107.057554 ; PMID: 18296626
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Loss of a pyridoxal-phosphate phosphatase rescues Arabidopsis lacking an endoplasmic reticulum ATP carrier. DOI: 10.1093/plphys/kiac048 ; PMID: 35139220
Sequence:
cDNA Sequence
- >AT5G17400.1 TGCCCTGTCCTCCACCTCCAGCTTTGAAATTCACAGAAAATGATTATCTCTTTTCTATTTTATTGGCTTCTCAAAACGAAATAACGAAATCGCCTCCTCTTCTTCTCCTCCTCGACCTGGAAATCAATCTTTCGCCGCCGAGTTCTTCTCTCTGCGGCGGAGAATCAATTAGCAATCTCCAGAATTAGGTGAGGGAAAAGAGGATGGCTTTGATCGGAAAATCCGAGAGATTCTCTGCTGATTTTGTGATGGGTGGTGCTGCAGCCATTGTTGCCAAATCTGCAGCTGCTCCAATCGAAAGGGTGAAGCTTTTACTGCAGAATCAAGGGGAGATGATAAAGACTGGACATCTCATAAGACCTTACACTGGTTTGGGTAATTGCTTTACCAGAATCTATAGAGAAGAAGGTGTTTTGTCCTTTTGGAGAGGAAACCAAGCCAATGTCATACGATATTTCCCTACACAGGCTTCCAACTTTGCATTTAAAGGTTACTTCAAGAACCTTCTTGGATGTTCGAAAGAGAAAGATGGTTACTTGAAGTGGTTTGCTGGAAATGTAGCTTCGGGAAGTGCTGCTGGAGCAACAACTTCCTTGTTTCTGTACCATTTGGATTATGCGCGGACCCGTTTAGGCACTGATGCAAAGGAATGTTCTGTTAATGGCAAGAGACAGTTTAAAGGGATGATCGATGTGTATCGTAAAACTTTGTCAAGTGACGGTATTAAAGGTCTTTACCGTGGATTTGGTGTGTCAATAGTGGGAATCACTCTTTACCGAGGAATGTATTTTGGGATGTACGACACCATCAAACCCATTGTGTTAGTCGGTTCCTTAGAGGGAAACTTCTTGGCTAGTTTTCTATTGGGTTGGAGTATTACTACCTCTGCAGGCGTCATTGCTTACCCTTTTGACACACTTAGGAGGAGAATGATGCTTACATCAGGACAACCTGTTAAATACCGGAACACCATTCATGCCTTAAGAGAGATATTGAAGTCGGAAGGGTTCTATGCGCTATATAGAGGAGTTACTGCGAACATGCTTCTTGGAGTAGCAGGAGCAGGAGTGCTTGCGGGATATGATCAGCTTCACCAGATTGCTTATAAGCATTGGGTTCAGTAGTTTTGGACCAAACCCGAAACGATGACAATGAAAGCTGAGCTCAAAAAGAGAAGGTTAGTAAACACCAAGAAGTCTCACTTGCTTTCCAATGTATTGTGTTAATTAACAGAATCTCGGAATCATTAACCGATTGAACCAGCAGAAGATAGGGAAAATTGTTCATAGTTCTTGTGCAGTAACATTGTTATATCAATAATCCAAGAAAGGCCTATTTGATTTTTGTGTA
CDS Sequence
Protein Sequence