Gene Details:
- Gene ID: AT5G18010
- Gene Symbol: SAUR19
- Gene Name: small auxin up RNA 19
- Description: SAUR-like auxin-responsive protein family;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Literature:
- The response regulator 2 mediates ethylene signalling and hormone signal integration in Arabidopsis. DOI: 10.1038/sj.emboj.7600337 ; PMID: 15282545
- Transcriptional divergence of the duplicated oxidative stress-responsive genes in the Arabidopsis genome. DOI: 10.1111/j.1365-313X.2004.02295.x ; PMID: 15634198
- Leucine-rich repeat receptor-like kinase1 is a key membrane-bound regulator of abscisic acid early signaling in Arabidopsis. DOI: 10.1105/tpc.104.027474 ; PMID: 15772289
- yucca6, a dominant mutation in Arabidopsis, affects auxin accumulation and auxin-related phenotypes. DOI: 10.1104/pp.107.104935 ; PMID: 17885085
- Transcriptional profiling of pea ABR17 mediated changes in gene expression in Arabidopsis thaliana. DOI: 10.1186/1471-2229-8-91 ; PMID: 18783601
- A role for the anaphase promoting complex in hormone regulation. DOI: 10.1007/s00425-011-1374-3 ; PMID: 21327815
- Tissue-specific expression of SMALL AUXIN UP RNA41 differentially regulates cell expansion and root meristem patterning in Arabidopsis. DOI: 10.1093/pcp/pct028 ; PMID: 23396598
- Combining growth-promoting genes leads to positive epistasis in Arabidopsis thaliana. DOI: 10.7554/eLife.02252 ; PMID: 24843021
- SUPPRESSOR OF PHYTOCHROME B4-#3 Represses Genes Associated with Auxin Signaling to Modulate Hypocotyl Growth. DOI: 10.1104/pp.16.00405 ; PMID: 27342309
- Brassinosteroid signaling converges with SUPPRESSOR OF PHYTOCHROME B4-#3 to influence the expression of SMALL AUXIN UP RNA genes and hypocotyl growth. DOI: 10.1111/tpj.13451 ; PMID: 27984677
- Mutation of a Conserved Motif of PP2C.D Phosphatases Confers SAUR Immunity and Constitutive Activity. DOI: 10.1104/pp.19.00496 ; PMID: 31311832
- The Asymmetric Expression of SAUR Genes Mediated by ARF7/19 Promotes the Gravitropism and Phototropism of Plant Hypocotyls. DOI: 10.1016/j.celrep.2020.107529 ; PMID: 32320660
- HBI1 acts downstream of ERECTA and SWR1 in regulating inflorescence architecture through the activation of the brassinosteroid and auxin signaling pathways. DOI: 10.1111/nph.16840 ; PMID: 32746499
Sequence:
cDNA Sequence
- >AT5G18010.1 TCATCAACCAACAACAAGCATTCCAATAACTTGAATCTTTTCATACATCTTCAAGAGCTTCATAATAATTCAAACTTCTTTTATTTAAAATAAAATAAAAATGGCTTTCGTGAGAAGTCTATTGGGAGCAAAGAAGATTCTAAGCCGCTCCACCGCAGCAGGATCTGCGGCACCAAAAGGGTTTCTTGCGGTGTACGTAGGAGAGAGCCAGAAGAAGAGATATTTGGTGCCGCTCTCATACTTGAGCCAACCGTCATTTCAAGCTCTGCTCAGTAAATCCGAAGAAGAGTTTGGGTTTGCTCATCCGATGGGTGGCTTAACGATCCCTTGTCCCGAAGATACTTTCATCAATGTGACTTCTCGGCTCCAATGAAGATGATCCAACATTTTTTCCTTCAGTTAGAAATAGACTTATTCATTGTAAATACATGAGCTTTTTTCTCTTTCTTCTTGAAAGAGTTGTTCTAAAAGTGTAGAAAGTGAAATACAAAATTAATGTTATATACAAACTTCATGTCAATACATTTTTGATCGCTCATTGAAAAAGAAAGACGACACCAAATTCATCAATCAAAAAACTACTCTAATTATAGTTTCATGTTGATTAAAAACAATTAAGTGGAACATCTAACA
CDS Sequence
Protein Sequence